(2001). 3xFLAG epitope tails were added to the ends of the sopA, sopB and sopD gene. The 3xFLAG epitope is a sequence of three tandem FLAG epitopes (22 aa). A pair of primers was designed to amplify a 3xFLAG and find more kanR coding sequence using plasmid pSUB11 (Uzzau et al., 2001). The 3′-ends of these oligonucleotides were complementary to the first 20 nt of the pSUB11 3xFLAG coding region (GACTACAAAGACCATGACGG, forward primers) and to the 20 nt of the pSUB11 priming site 2 (CATATGAATATCCTCCTTAG, reverse primers). The 5′-ends

of the oligonucleotides were designed to be homologous to the last 40 nt of each tagged gene, not including the stop codon (forward primers), and to the 40 nt immediately downstream of the gene stop codon (reverse primers). For in vitro studies, bacteria were grown under different culture conditions. To mimic the intestinal environment (Miki et al., 2004) bacteria were grown overnight at 37 °C without aeration in a Luria–Bertani (LB) broth containing 0.3 M NaCl. An intracellular milieu was recreated by growing bacteria overnight in MgM minimal medium containing 0.1%

casaminoacids at 37 °C www.selleckchem.com/products/Roscovitine.html with aeration (Miki et al., 2004) at different pH. Early and late intracellular conditions were mimicked by growing bacteria at pH 6 or 4.5, respectively. sopD∷3xFLAG cat∷FLAG strain was used as control for in vitro experiments; SopD is a dual effector because it is translocated into

host cells by both TTSSs (Brumell et al., 2003). For in vivo studies, bacterial inocula used to infect cells or animals were prepared by growing the tagged strains overnight under SPI-1 noninducing MYO10 conditions (LB at 28 °C) as described previously (Giacomodonato et al., 2009). In this way, the residual expression of SopB from in vitro bacterial growth was ruled out. Cultures were centrifuged, diluted in sterile saline and inoculated to cell cultures or mice. Viable bacteria in the inoculum were quantified by dilution and plating onto LB agar plates with appropriate antibiotics. For the isolation of cell-associated proteins, 1.5 mL of bacterial cultures were centrifuged and resuspended in 100 μL of H2O and immediately mixed with 100 μL of Laemmli buffer. For the isolation of proteins released into the culture supernatants (secreted proteins), bacteria were pelleted by centrifugation and 2 mL of supernatant was collected from each sample. Supernatants were then filtered (0.45 μm pore size), and the proteins were precipitated with 25% trichloroacetic acid and sedimented by high-speed centrifugation (14 000 g for 30 min). The pellet was washed in cold acetone and resuspended in phosphate-buffered saline (PBS) and Laemmli buffer. Four independent extractions for each sample were added together to minimize differences in protein recovery from sample to sample.