3B). Therefore, there were no changes in the expression of Bcl2

family members that could provide a simple explanation for the reduced fitness of IL-7R− F5 T cells. Surprisingly, few Bcl2 family members were differentially expressed between IL-7R- and IL-7R+ F5 T cells. However, it was possible that IL-7 signalling in vivo was regulating survival by influencing abundance of these key apoptosis regulators at a post translational level, for instance by influencing protein stability or turnover. We therefore assessed by Western blot the levels of anti- and pro-apoptotic proteins in cell lysates from samples of IL-7R− and IL-7R+ F5 Dabrafenib in vitro T cells. As data in Fig. 6 show, abundance of Bcl2, Bcl-xL, Mcl1, Bad and Puma were similar between IL-7R– and IL-7R+ F5 T cells, consistent with prior transcript analysis (Supporting Information Fig. 3A), and Torin 1 FACS analysis in the case of Bcl2 (Fig. 3). Previous studies of cell lines have shown that IL-7 can promote cell survival by inactivating Bad through its Akt/PKB-dependent phosphorylation 31. However, detailed analysis of F5 transgenic mice that over-express Bad, consequently inducing thymocyte apoptosis 32 (Supporting Information Fig. 4A), revealed no evidence of defects in naïve T-cell survival in vitro (Supporting Information Fig. 4B) or in vivo (Supporting Information

Fig. S4C–S4E) and furthermore phosphorylation of Bad, and thereby its inactivation, is even increased in IL-7R– F5 T cells (Supporting Information Fig. 4F). Examining Bid and Bim-L levels revealed small but significant reductions in protein abundance of both in IL-7R– F5 T cells, which in the case of Bid, mirrored differences observed transcriptionally (Supporting Information Fig. 3B). Furthermore, the active cleaved form of Bid, tBid, was not detected in either IL-7R+ or IL-7R– F5 T cells. Thus, intriguingly, the only detected changes in abundance or activation of anti-apoptotic and BH3-only molecules in IL-7R– F5 T cells would rather be expected to inhibit their apoptosis. Finally, we wished to examine whether there was any evidence

that mitochondrial homeostasis was perturbed in the absence of IL-7 signalling in T cells. We therefore examined mitochondrial integrity of IL-7R– Carbohydrate F5 T cells using the cationic dyes mitotracker red and TMRE that are actively taken up by mitochondria and whose retention is dependent on the integrity of the mitochondrial membrane. While total mitochondrial mass was similar between IL-7R– and IL-7R+ F5 T cells (Fig. 7A), we found that both mitotracker red (Fig. 7B) and TMRE staining (Fig. 7C) of IL-7R– F5 T cells was reduced as compared with control IL-7R+ F5 T cells, suggesting that the integrity of mitochondria in these cells is compromised as compared with control F5 T cells. Such a finding is consistent with the rapid induction of caspase activity and apoptosis observed in IL-7R– F5 T cells (Fig. 2).

Sotrastaurin is a potent inhibitor of alloreactivity in vitro, while it did not affect Selleckchem Paclitaxel Treg function in patients after kidney transplantation. Various immunosuppressive regimens are used in autoimmune disease and clinical transplantation, balancing between clinical efficacy and safety profiles. In solid organ transplantation, regimens to prevent rejection of the donor organ usually include two to four classes of immunosuppressive drugs, of which calcineurin inhibitors (CNI) are the cornerstone. However, well-known side effects include nephrotoxicity, glucose intolerance, malignancy,

hypertension and neurotoxicity [1]. Therefore, there is a strong clinical need for safer and more selective immunosuppressive agents that specifically target a particular molecule or pathway. Interference in the protein kinase C (PKC) signalling pathway by the novel immunosuppressant

sotrastaurin provides this opportunity. PKC is a family PLX4032 of serine and threonine kinases that phosphorylate a wide variety of target proteins which are activated after T cell receptor and co-stimulation receptor (i.e. CD28) triggering [2]. PKC members are divided into three subclasses due to their structure and type of activation: classical, novel and atypical PKC. The classical isoforms α and β and the novel isoform θ are essential for T and B cell activation [3]. Most isoforms are expressed ubiquitously, whereas PKC θ is found predominantly in haematopoietic (and muscular) cells. After accumulation of PKC ε and PKC η in the immunological synapse [4], PKC θ is translocated to the membrane upon T cell receptor activation and activates the nuclear factor (NF)-κB transcription factor. NF-κB binds to the promoter of interleukin (IL)-2, interferon (IFN)-γ and also of forkhead box protein 3 (FoxP3) genes, prominent players in immune reactivity and regulation

[5-7]. Sotrastaurin is a low molecular mass synthetic compound that potently inhibits the PKC α, β and the θ isoforms resulting in selective NF-κB inactivation, in contrast to calcineurin inhibitors, which inhibit both the NF-κB, p38 and nuclear factor of activated T cells (NFAT) signalling Idoxuridine pathways [8, 9]. Currently, the effect of sotrastaurin on FoxP3+ regulatory T cells and their function is unknown. It has been reported that calcineurin inhibitors affect the expansion and function of controlling regulatory CD4+CD25highFoxP3+ T cells (Tregs) while others, such as rabbit anti-thymocyte globulin (rATG) and mammalian target of rapamycin (mTOR) inhibitors, create a milieu by which these suppressor cells can proliferate [10-12]. Because Tregs require T cell receptor-mediated NF-κB activation and cytokines of the IL-2 family for their development, maintenance and suppressive function, their number and function might be influenced by sotrastaurin. Sotrastaurin has recently been tested in psoriasis [13] and kidney transplantation [14, 15]. Oncology trials in melanoma and lymphoma patients (ClinicalTrials.

After biotinylation, tetramers are formed by mixing the biotinylated peptide–HLA complex with fluorophore-labelled avidin [22,46]. The traditional avidin-based tetramers have been superseded by complexes of five HLA/peptides, known as pentamers. HLA class II tetramers have been more

difficult to produce because the peptide complexes are less stable than HLA class I and interactions with the TCR are weaker than HLA class I/ CD8+ T cell interactions [46]. None the less, recombinant class II molecules that incorporate ‘leucine zipper’ motifs can be produced in stably transfected Drosophila cells and purified by affinity chromatography [50]. Because of the very low frequencies of CD4+ T cells specific for self-antigens, this assay often utilizes an in vitro amplification step BGJ398 concentration to increase the threshold of detection [51]. Loading tetramers with modified agonist peptides can increase the tetramer’s binding affinity and allow low-avidity T cell populations to be detected [52,53]. Parallel sorting of tetramer-positive cells, followed by RNA transcription profiling, enables extensive determination of NVP-BEZ235 their functional phenotypes [54]. The recently developed fluorescent quantum dots have been used to label HLA class I tetramers. Quantum dots have narrow emission spectra, making

them ideal for multiplexed tetramer staining [55]. Quantum dots may also prove useful for labelling HLA class II reagents. Advantages. Tetramers and pentamers are unique reagents

because they can identify antigen-specific T cells directly. This property makes them very useful for validating epitopes identified by other means. Ex-vivo tetramer staining (class I and class II) enables direct estimation of the frequency of antigen-specific T cells [56]. Disadvantages.  Class II tetramers are not suitable for use in routine clinical monitoring to detect biomarkers of disease. In vitro expansion of the antigen-specific T cells is required to increase their frequency to detectable levels and may lead to over- or under-estimation of the cell populations depending upon their capacity to proliferate in vitro. Furthermore, large pheromone volumes (∼50 ml) of blood are required to isolate the required numbers of PBMC. One possible limitation of both class I and class II tetramer assays is that low-affinity TCR-bearing cells may not be detected. Therefore, tetramer staining combined with proliferation and/or cytokine secretion assay may yield more information than either assay alone [57]. HLA-A*0201 pentamers (ProImmune, Oxford, UK) loaded with the autoantigenic epitopes of choice, positive control viral epitope(s) and negative control epitope. Cell sample, e.g. blood sample (RBC-depleted), PBMCs or T cell line. Pro5® recombinant MHC pentamer conjugated to the fluorescent label of choice (note: ensure that the stock pentamer is stored consistently at 4°C in the dark, with the lid tightly closed).

Methods: We established protocols for enzymatic α2,6-sialylation (ST6GalNAc-I or II) or α2,3-sialylation (ST3Gal1; adds NeuAc to galactose) of IgA1 O-glycans of an asialo-IgA1 myeloma protein (Ale) that mimics the Gal-deficient IgA1 in IgAN patients. The products of sialyltransferase reactions were assessed by high-resolution

mass spectrometry and ELISA with the GalNAc-specific lectin from Helix aspersa (HAA). Results: Changes in SDS-PAGE mobility of the IgA1 heavy chain indicated that both enzymes were active. Enzymatic sialylation of the myeloma protein generated sialylated IgA1 that mimics the circulating nephritogenic IgA1 in IgAN patients, characterized by α2,6-sialylated GalNAc, or the IgA1 typical for healthy controls, characterized by an α2,3-sialylated Ibrutinib datasheet Gal attached to GalNAc. Lectin ELISA was used to assess binding to Deforolimus datasheet the IgA1 before and after the enzymatic reactions. α2,6- as well as α2,3-sialylation of IgA1 markedly decreased reactivity with the HAA lectin. Neuraminidase treatment (to remove sialic acid) completely restored the level of lectin reactivity. Thus, lectin binding to GalNAc decreased after sialylation of Gal on

a nearby glycan in the cluster of O-glycans of the IgA1 HR. Conclusion: Neuraminidase should be used to remove sialic acid from serum IgA1 before a lectin assay to assess the total content of HR Gal-deficient GalNAc. Our in vitro enzymatic sialylation model will be useful to study the biological roles of NeuAc in the IgA1 HR in the pathogenesis of IgAN. SUZUKI HITOSHI1, YANAGAWA HIROYUKI1, SUZUKI YUSUKE1, KIRYLUK KRZYSZTOF2, GHARAVI ALI G2, MATSUOKA JOE3, MAKITA YUKO1, JULIAN BRUCE A4,5, NOVAK JAN5, TOMINO YASUHIKO1 1Division of Nephrology, Department of Internal Medicine, Juntendo University Faculty of Medicine; 2Department of Medicine, Columbia University; 3Clinical Research Center, Juntendo University Faculty of Medicine; 4Departments of Medicine, University of BCKDHB Alabama at Birmingham; 5Departments of Microbiology, University of Alabama at Birmingham

Introduction: IgA nephropathy (IgAN) is the most common form of primary glomerulonephritis worldwide. There is increasing evidence that galactose-deficient IgA1 (Gd-IgA1) and Gd-IgA1-containing immune complexes are important players in the pathogenesis of IgA nephropathy (IgAN). Moreover, serum levels of Gd-IgA1-specific antibodies (IgG and IgA), responsible for the formation of immune complexes with Gd-IgA1, are also elevated in IgAN. In the present study, we assessed a novel noninvasive approach using multi-biomarkers combined with analysis of clinical data by a logistic model as a diagnostic test for IgAN. Methods: We compared serum levels of IgA, IgG, Gd-IgA1, Gd-IgA1-specific IgG and Gd-IgA1-specific IgA in 135 IgAN patients, 79 patients with non-IgAN chronic kidney disease (CKD) controls and 106 healthy controls.

PPAR-γ has been proposed as a transcription factor that activates the HO-1 gene in silico [5]. Studies have shown that PPAR-γ and HO-1 exert beneficial effects in neurodegenerative disorders. Interestingly, functional binding sites for the transcription factor C/EBPβ can be found in the promoter regions of PPAR-γ Compound Library datasheet and HO-1 [36, 37]. In the present study, IL-13 markedly abolishes LPS-induced C/EBP-β, PPAR-γ, and

HO-1 expressions. Consistent with previous studies using brain injury models, the results here demonstrate that C/EBP-β regulation provides a potential new avenue for the development of therapeutic strategies to prevent hyperactivated microglia-induced neuronal damage. Pathologic conditions and proinflammatory stimuli in the brain induce COX-2, a key enzyme in arachidonic acid metabolism. COX-2 mediates the production www.selleckchem.com/products/fg-4592.html of prostanoids, such as PGE2, which induce fever and pain, increase vascular permeability, and recruit inflammatory cells to sites of inflammation. In previous studies, Yang et al. [6] found that COX-2 and PGE2 appear to be involved in IL-13-induced death of activated microglia. Their findings

suggest that the death of activated microglia may act as an endogenous mechanism for the resolution and termination of brain inflammation [6]. The current study demonstrates that IL-13 enhances apoptosis in activated microglia and this plays a crucial role in reducing brain inflammation. C/EBP-α, a basic leucine zipper transcription factor, has been identified in many studies as playing a critical role in COX-2 expression in the Methisazone transcriptional activation of the COX-2 promoter [38]. C/EBP-α binds to C/EBP enhancer elements and is essential for inducing COX-2 expression by LPS, TNF-α, and IL-1β. Hsieh et al.

[39] showed that attenuated C/EBP-α expression in COX-2 activation in fat inflammation is important in the development of insulin resistance and fatty liver in high fat-induced obese rats. In addition, signaling cascade coupling of COX enzymes with PLA2s may be a key mechanism in the propagation of inflammatory reaction. Recently, PLA2s have been found to play a prominent role in the regulation of C/EBP-α gene expression. The activation of C/EBP-α is under the control of different signaling pathways and can be activated via PLA2 pathway more than the influence of COX-2 expression [40]. The hippocampus is part of a group of structures forming the limbic system and is also a part of the hippocampal formation, which also includes the dentate gyrus, subiculum, and entorhinal cortex. Different components of the limbic system play critical roles in various aspects of emotions, fear, learning, and memory [41-44].

No. 88–7100-22; IL-12p70, Cat. No. 88–7121-22; TNF-α, Cat. No. 88–7324-22;

IL-6, Cat. No. 88–7064-22; IL-10, Cat. No. 88–7104-22) according to the manufacturer’s instruction. M-BMMs on day 5 from WT and Klf10-deficient mouse were stimulated with 1 μg/mL LPS for 12 and 24 h. Culture supernatants were analyzed for NO by the Griess reaction. Briefly, 50 μL supernatant was incubated with 50 μL Griess reagent for 5 min at room temperature, and NO2 level was determined by measuring the absorbance at 540 nm relative to the reference sample. Whole cell lysates were prepared by complete Lysis-M Ibrutinib mouse kit (Roche; Cat. No. 04719956001) and the concentration was determined Protein Tyrosine Kinase inhibitor by the bicinchoninic acid protein assay (Thermo Scientific; Lot # MC 155209). The same amounts of protein were resolved on SDS-PAGE gels, transferred to polyvinylidene fluoride membrane. After blocking with 5% nonfat dry milk/PBS, the membranes were further incubated with the indicated primary antibodies overnight, reacted with a secondary antibody, and then protein bands were visualized by ECL. Cells were harvested and incubated with relative antibodies for 30 min on ice, washed, and analyzed in a FACS calibur flow cytometer (Becton Dickinson).

The promoter of IL-12p40 and its mutants were produced by PCR-based Cell press amplification and subcloned into the pGL3-Enhancer Vector to forming luciferase report plasmid. Human embryonic kidney (HEK293) cells were cotransfected with 100 ng luciferase reporter plasmid, 10 ng thymidine kinase promoter-Renilla luciferase reporter plasmid, plus the pCDNA3-Klf10, or control vector. After 48 h, luciferase activities were determined by the Dual-Luciferase Reporter Assay System (Promega, Cat. No. E10910) according to the manufacturer’s instructions. The primers were as followed: P40-promoter-WT: CTCGAGTAGGCATGATGTAAACAGAAAT,   AAGCTTCTAGATGCAGGGAGTTAGC P40-promoter-Δ: CTCGAGTCATTTCCTCTTAACCTGGG,   AAGCTTCTAGATGCAGGGAGTTAGC P40-promoter-mut:

CTCGAGTAGGCATGATGTAAACAGAAATTA   GTATCTCTGCCTCCTTCCTTTTTCCAATCCCCGA,   AAGCTTCTAGATGCAGGGAGTTAGC Chromatin-immunoprecipitation assays were done essentially as the manufacturer’s protocol (Active motif, CHIP-ITTM Express). The immunoprecipitated DNA fragments were then analyzed by semi-qPCR and qPCR. The primers used were as followed: GAPDH: TTACTTTCGCGCCCTGAG, GCGGTTCATTCATTTCCTTC IL-12p40: TGCCGCCTCTATTCACCTTA, CTGACTAGTCTCAATTGCAACA Data are presented as the mean ± SD. Statistical significance was determined by Student’s t-test. A value of p < 0.05 was considered to be statistically significant. We thank L. Lu for discussions; F. Xing for assistance with manuscript editing.

72 The situation may differ at the maternal–fetal interface, however, because of the unique www.selleckchem.com/screening/tyrosine-kinase-inhibitor-library.html patterning

of MHC molecules in placental cells. Syncytiotrophoblast, which abundantly expresses B7-H1, represses virtually all MHC expression, effectively ruling out the possibility that in cis signaling to the T cell with MHC would occur from these cells. Our data suggest that these cells can in fact suppress TCR-mediated events on T cells in trans.71 Other trophoblast cells express B7-H1, including extravillous trophoblast cells, that express a restricted array of MHC. Although most investigators do not consider these cells to function as APCs, which possibility has not been formally ruled out. B7-H1 and HLA-G, for example, are co-expressed Dinaciclib solubility dmso on the surface of invading cytotrophoblast cells and those found in the chorion membrane (Fig. 2). Another possibility is that reverse-signaling through B7-H1 can occur, transmitting a signal not to the lymphocyte, but to the syncytiotrophoblast and/or cytotrophoblast itself. In the mouse, it is not entirely clear as yet whether the trophoblast, decidua, or both express B7-H1.40,48 Nonetheless, given its suppressive role in controlling self-reactive T cells and autoimmunity, we and others

tested whether maternal B7-H1 or PD-1 is mandatory for successful allogeneic pregnancy. Guleria and colleagues reported that systemic blockade of B7-H1 but not B7-DC disrupted allogeneic, but not syngeneic, pregnancy in mice.40 Fetal resorption was also observed in allogeneic pregnancies using 4-Aminobutyrate aminotransferase B7-H1-deficient

mice. This group also found that B7-H1 may influence the local cytokine milieu at the maternal–fetal interface, as IFN-γ and IL-17 were increased, whereas IL-4 and IL-5 were reduced in the placenta of B7-H1-deficient mice.73 These authors additionally provide evidence to propose that the requirement for B7-H1 in allogeneic pregnancy lies in its utilization by maternal TRegs to control maternal anti-fetal T cells.73 On the other hand, we have shown in several models of pregnancy that genetic deletion or blockade of PD-1 has no obvious detrimental effect on pregnancy (Fig. 3).74 Similarly, in our hands, dams lacking B7-H1 carry allogeneic pups to term unimpeded.74 We carried these studies a step further to discern whether PD-1 on maternal T cells play any role in the maternal response to fetal antigen. Adopting a model of a defined fetal alloantigen, ovalbumin, combined with maternal anti-ovalbumin T cells, we showed that PD-1 prevents over-accumulation of fetal antigen-specific T cells in maternal lymphoid organs, possibly via a mechanism involving apoptosis.

Although viability of progeny and effective recombination could not be established, it may be hypothesized that arrhizus and delemar represent a single biological species. The apparent phylogenetic and physiological separation of the lineages TGF-beta inhibitor then would deserve the status of varieties at most. The varieties are similar in ecology and pathogenicity. The species Rhizopus arrhizus[14] was described 3 years prior to R. oryzae.[21] Fischer’s description is short, lacks figures, and no type material

is known to exist. In contrast, the description of R. oryzae by Went & Prinsen Geerligs [27] is comprehensive, includes figures, and the strain CBS 112.07 was deposited in the CBS reference collection by Went in 1907 as type strain of Rhizopus oryzae. Consequently, the name R. oryzae was preferred over R. arrhizus by numerous authors.[15, 32, 33] A further reason of the unpopularity of the name arrhizus was that Fischer [14] described the columella of R. arrhizus as subglobose selleck inhibitor to applanate, which was considered to be unusual for this species.[15] For the combined reasons mentioned above, Schipper [15]

treated R. arrhizus as a doubtful species. Ellis et al. [16] took up the name R. arrhizus again by designating NRRL 1469 as ex-neotype strain of R. arrhizus. This action is as legitimate as Schipper’s [15] decision, so that the species today has two nomenclaturally valid names, sanctioned by different interpretations of the protologues. In their comprehensive morphological study on the genus Rhizopus, Zheng et al. [17] preferred the name R. arrhizus. In our opinion the description of R. arrhizus by Fischer [14] is conclusive. It contains all features that need to be known for a correct identification of the species whereby it may be noted that mucoralean fungi are more remote from each other than e.g. highly evolved ascomycetes, and generally allow morphological recognition at the species level by a limited number of key features. Sporangiophores were described as 0.5–2 mm long, sporangia 120–250 μm in diameter and rhizoids (designated in German as ‘Haftfüsschen’) short and less branched, a

feature that the author expressed in the name. Subglobose to applanate columellae were also described to be present in R. arrhizus by Hagem (1907, as Mucor arrhizus), Hanzawa (1912, for R. delemar), and Zheng et al. [17]. We agree with MRIP Ellis et al. [16] that the protologue is sufficiently clear to allow unambiguous indication of a neotype, NRRL 1469 and therefore favor the use of the name Rhizopus arrhizus over R. oryzae. Rhizopus arrhizus A. Fisch., in Rabenh. Krypt.-Fl., Ed. 2 (Leipzig) 1(4): 233. 1892 var. arrhizus, MB416882 Mucor arrhizus (A. Fisch.) Hagem, Neue Untersuchungen über Norwegische Mucorineen. p. 37. 1907/08. = Rhizopus oryzae Went & Prinsen Geerl., Verh. Kon. Ned. Akad. Wet., Amsterdam, Sect. 2, 4: 16. 1895. = Chlamydomucor oryzae Went & Prinsen Geerl., Verh. Kon. Ned. Akad. Wet.

[5] Standard fluorescence microscopy using a good quality 60× or 100× oil immersion objective lens is adequate for visualizing immunolabelled primary cilia, ZD1839 although confocal microscopy may offer clearer images and allow scope for three dimensional reconstruction. Although most renal epithelial cells bear a cilium, not every section of a cell will contain the cilium. However, a longitudinal section through the

lumen of a tubule or duct will typically contain several primary cilia. The length of primary cilia is a feature that has been linked to their sensory sensitivity with regard to flow.[63-65] The length of primary cilia labelled with anti-tubulin can be measured for cultured cells or kidney sections using image analysis software such as AnalySIS (Olympus), IMARIS (Bitplane) or Image J.[5, 66] Several independent replicates should generally be examined for each time point or treatment, and multiple spatially separated examples of cilia obtained from each replicate to ensure results are representative. It is possible to obtain repeated measurements of average primary cilium length from the same kidney in the case of clinical renal biopsy series.[5] Cilia in preparations of cultured cells usually lie

flat and their full extent is easily visualized and measured.[47] In kidney sections, cilia are not uniformally oriented and longer examples may not be completely contained in one section or plane of focus. Images of cilia oriented parallel to the plane of from focus are collected from several tubules or ducts of each kidney. This approach undoubtedly biases against examples lambrolizumab of longer cilia that are less likely to be contained in a single section or plane of focus, and underestimates cilium length to some degree. However, this method has successfully been

used to detect increases in renal primary cilium length after renal injury in human patients and mouse models.[5, 10, 11] The use of more sophisticated fluorescence imaging approaches for accurately reconstructing and measuring the length of primary cilia has recently been discussed.[67] These strategies accurately measure primary cilia using three dimensional reconstruction from confocal optical sections and involve correction for distortion that occurs along the Z axis. This allows more complete sampling of cilia, including longer examples. As the significance of primary cilia, including those of the kidney, has become apparent, the number of studies examining their properties and function has increased rapidly. Traditional electron microscopy techniques continue to make valuable contributions because of the high resolution they offer. Antibodies raised against a range of cystic kidney disease proteins and other ciliary components have revolutionized immunofluorescence analysis of renal primary cilia.

3%), five strictures (26.3%) and a combination of both in nine cases (47.4%) when suturing the urethral anastomosis in a multilayer fashion including perineal muscle flaps to bolster the anastomosis.[12] In a series

of 31 free sensate osteofasciocutaneous fibula flaps and 6 RFF with prelaminated urethras, Schaff and Papadopulos presented 32.4% out of 37 cases involving urethral strictures and 16.2% (6 out of 37 cases) involving fistulas. Five out of the six fistulas originated at the connection site of the lengthened urethra to the prelaminated urethra.[8] In both our cases, urological complications occurred leading to open urethroplasties. Twelve months postoperatively, both patients were able to urinate through a competent Z-VAD-FMK supplier neo-urethra while standing. We do not think

that the occurrence of urological complications is related to the salvage-procedure but rather reflects the generally high incidence in phalloplasties. ICG-001 order Donor-site morbidity after the RFF harvesting is considered a major drawback. Incomplete graft-take after donor site coverage with STSG or FTSG, functional impairment, prolonged swelling of the hand and sustained paresthesia in the hand, and neuroma formation have all been described.[15-17] Moreover, the scar on the forearm is frequently perceived as a stigma for transsexuals. In the presented cases, no donor-site complications or morbidities were encountered. The bilateral Casein kinase 1 scars were not perceived as a major problem by either patient. Summarizing, in two cases of complete loss of the neo-urethra after total phalloplasty using a free sensate RFF in the Chang-design, we successfully salvaged the neo-urethra and reconstructed the outer lining of the neo-phallus using a second RFF. Twelve months postoperatively, both patients were able to urinate while standing. The aesthetic appearances were rated excellent and good, respectively. Sensitivity

was not impaired, as both patients reported an excellent tactile and erogenous sensitivity. In our experience, the presented technique is a valuable alternative to primary urethrostomy in such cases. It is clear that additional techniques for eliminating or at least mitigating partial flap necrosis as a major drawback of the standard tube-in-tube phalloplasty are needed. We propose the primary usage of a flap-in-flap technique, e.g. the combination of a free or pedicled sensate anterolateral thigh flap for neo-phallic construction and a free RFF or a pedicled groin flap for neo-urethral construction. Since only few reports on flap-in-flap approaches are presently available,[18, 19] the feasibility and safety of such a technique needs further assessment. “
“Free flap vascular pedicle avulsion represents an extremely rare complication in reconstructive microsurgery. Very few cases have been reported in the literature, most of them identified in free flap breast reconstruction.