196 1.711 19.907 32.261 12.354 7,53 UBC 21.665 0.163 1.422 19.475 30.387 10.912 6,60 YWHAZ 24.720 0.193 1.685 22.733 32.853 10.120 6,86 Note. S.e.m, standard error of mean; CtCV%, Coefficients of variations of candidate reference genes. Results of validation programs In order to determine the stability of genes and thus find the best endogenous controls, the data were analysed by geNorm and NormFinder. In these analyses, medians were used to replace missing values because they occurred due to inconsistencies between replicates rather than from low expression. The ranking of the gene expression stability

values (M) of the tested endogenous control genes using geNorm is illustrated in Figure 1.A. The genes with the highest M, i.e. the least stable genes, gets stepwise excluded until the most stable genes remain. The Staurosporine clinical trial best two genes are ranked without distinguishing between them. HPRT1 and PPIA were identified as the most stable pair of genes, followed by PGK1 as the third most stable gene. Furthermore, pairwise variation were also calculated using geNorm in order to determine the optimal BIBW2992 concentration number of genes required for normalization, Figure 1.B. The analysis showed that HPRT1 and PPIA may be sufficient

for calculation of the normalization ACY-1215 factor and normalization to genes of interest, since the V2/3 value is in this analysis equal to the cut-off value of 0.15 [19]. However, there is a gradual decrease in the pairwise variability plot and thereby an improvement to the normalization factor Mannose-binding protein-associated serine protease by adding additional genes to the calculation. Nevertheless, two or three genes would be satisfactory for normalization according to the cut-off value of 0.15. While geNorm uses a pairwise comparison approach, NormFinder first estimates the intra-group and then the inter-group variability of expression of a control gene [17]. In contrast to the geNorm results, NormFinder ranked RPLP0 as the most stable gene, with TBP and GUSB closely behind as second and third, respectively (Figure 2). However, using this algorithm the combination of IPO8 and PPIA turned out to have a lower stability score than the most stable single gene. Thus

this combination is more suitable for normalizing qPCR. There was considerably closer agreement between the geNorm and Normfinder results on the least stable genes, with the order of 4 out of 5 worst ranking genes being identical; ACTB, 18S, B2M and TFRC. These genes had a stability value more than twice so high (geNorm) and more than 3 times so high (NormFinder) as the best ranking genes. Figure 1 GeNorm analysis of the candidate reference genes. (A) Average expression stability values of reference genes. Genes are presented in an increasing order of stability from left to right with ACTB being the least stable gene and HPRT1 and PPIA the most stable genes. (B) Determination of optimal number of control genes for normalization.

In addition, these two sets of luxI and luxR homologous genes organized convergently in S. plymuthica G3 chromosome is characteristic of the most γ-proteobacteria [33, 35, 40]. The results were in line with the phylogenetic analysis (Figure 1), demonstrating that the LuxI family members from the genus of Serratia can be clustered into groups A and B according

to the main AHL signals produced by bacteria, but it is not species-specific. For example, S. marcescens SS-1 was classified into group A as SplI of G3, known to produce 3-oxo-C6-HSL. In contrast, Strain 12 and MG1 of S. marcescens were clustered into group B due to the production IWP-2 clinical trial of C4-HSL as was SpsI from G3. Hence, our data provide new evidence to support that AHL patterns in Serratia is strain-dependent, indicating the presence of some conserved protein structure-function characteristics that would determine this specificity and which would be worth SAR302503 order investigating in future. In addition, horizontal transfer of QS systems due to transposition or phage-mediated events have been described for the spnIR locus of S. marcescens SS-1 and the smaIR locus from strain 12 to 274 [16, 38, 41]. Consequently, the presence of two QS systems in G3 may have originated from horizontal

gene transfer amongst members of the genus Serratia. Gray and Garey (2001) also deduced that multiple LuxI and/or LuxR Astemizole homologues present within single species have been usually acquired from independent sources [40]. Further comparative analysis of AHL profiles using LC-MS/MS from the wild type G3 and E. coli DH5α expressing the recombinant plasmid carrying and splI or spsI showed that SplI is responsible for the synthesis of a broad range of AHLs with different substitutions whereas SpsI only drives the synthesis of AHLs with no substitutions on their acyl chains all of which are also made by SplI www.selleckchem.com/products/MS-275.html although some of them at much lower levels such as C4-HSL and C5-HSL. To our knowledge, the strain G3 is the only Serratia

so far described with the ability to produce 3 different families of AHLs according to substitutions in position 3 (none, 3-oxo and 3-hydroxy), although this can be due to the improved LC-MS/MS techniques used with higher sensitivity to detect lower concentration and broader range of AHL signals. The most abundant AHL signals identified by LC-MS/MS from G3 were 3-oxo-C6-HSL and C4-HSL although significant levels of C6-HSL, 3-oxo-C7-HSL and 3-hydroxy-C6-HSL were also detected [23]. However, the individual biological role of these AHLs remains unknown. Overlaps between the AHL profiles produced by different LuxI homologues in a single organism has been previously described in other bacteria such as Yersinia pseudotuberculosis [42] and this usually results in very complex QS regulatory cascades with a tight intraregulation between them [43].

Recently, the fluorescence in situ hybridization (FISH) technique has been commonly adopted [4] as a sensitive tool for determining aberrations on chromosomes. A major drawback of the FISH technique is that the fluorescence intensity only roughly reflects the local density of packed DNA inside chromosomes

and does not correspond to the topographic height [5, 6]. In addition, higher cost, staining, and the long analysis protocol make the FISH technique cumbersome, expensive, less accurate, and manual. learn more Internal interphase chromosome architecture and composition have not been addressed thoroughly because of the lack of visualization tools. There is a dire need for rapid real-time high-throughput genomic mapping and molecular marker identification tool for isolation of selleck chemical quantitative trait loci, and thereby designing crops with stress, insect, and drought tolerance [7]. Nanoscale imaging techniques allow us to examine the ultrastructure of cells in a detailed fashion [8]. Accurate topology of the chromatin (DNA and protein Pictilisib molecular weight composition) network inside a single chromosome has not yet been

characterized precisely. A chromosome is made up of DNA and associated proteins and other compounds in the nanoscale domain containing the genomic information. To understand the structure–property relationship of any organic material, quantitative compositional analysis at length scales below 100 nm is required [9]. Synchrotron-based nanoscale imaging tools offer the possibility to understand the embedding of the chromatin interaction networks inside the chromosomes. Advances in nanoscale imaging techniques especially synchrotron-based

radiation enable the molecular cytogenetics for accurate visualization and analysis of chromosomes at molecular resolution. Specifically, soft X-ray spectromicroscopy is well suited for analyzing the spatial distribution of specific elements in unstained wet or dry biological specimens Selleckchem Hydroxychloroquine [10–12]. The synchrotron-based scanning transmission X-ray microscopy (STXM) technique provides quantitative chemical mapping at a spatial resolution of 25 to 30 nm. Genomic resources on the minor crops are less investigated. In contemporary times, quinoa has become highly appreciated for its nutritional value, as its protein content is very high (14% by mass) [13]. However, relatively little is known about quinoa cytogenetics beyond the species’ chromosome number (n = 36). To unlock the potential of rapid cytogenetic analysis, nanoscale imaging is essential in the single-molecule characterization of chromosome architecture. Soft X-ray absorption spectroscopy using STXM at the nitrogen or carbon edge is sensitive to differentiate DNA and protein [11, 12], and can be used for chemical mapping of chromosomes.

Weight and body composition were determined via dual-energy x-ray absorptiometry (DEXA; Hologic Wi) after an 8 hour fast. Subjects then completed 12 vertical jumps learn more for height (VJ), followed by 1 repetition maximum lifts on the bench press (MBP) and leg press (MLP). Muscular endurance for bench press (RBP) and leg press (RLP) was measured by completing as many repetitions as possible

at 85% of the achieved MBP and MLP. Finally, the subjects completed a wingate power test on a cycle Selleck LGK 974 ergometer (insert manufacturer info) for measures of mean power (WMP) and peak power (WPP). The participants were then randomized into an eight day supplementation period with four resistance-training bouts spread over the eight days. Mood state and side effect questionnaires were completed each day after taking the supplement. After the supplementation period, the subjects returned to the lab to complete post-testing. All data were analyzed utilizing a 2 × 2 repeated measures ANOVA, treatment (PLC vs. DX) × time (pre-test vs. post-test) ANOVA. Ninety-five percent confidence intervals were also used. A Kruskal Wallis one-way analysis of variance was used for all survey data. A significance value buy PXD101 of p<0.05 was adopted throughout. Results There were no significant treatment × time interactions (p>0.05). There

were no significant changes in %BF (Δ-.43±.58;p=0.920), FM (Δ-2.45±5.72;p=0.988), or LBM (10.9±12.2;p=848). 95% CI did demonstrate a significantly greater loss in %BF for the DX group. There was a main effect for WPP (Δ100.5 ± 42.7W; p=0.001), MBP (Δ8.0 ± 12.9 lbs; p=0.001), and MLP (Δ80.0 ± 28.8lbs; p=0.001), with no significant differences between treatments (p=0.138-0.253). There was no significant difference

in mood states or appetites between the groups. Conclusion The results of this study Racecadotril revealed that the proprietary blend Dymatize XPAND® may be effective, when combined with 8 days of training, for reducing %BF. While not significant, greater gains in MLP were demonstrated in the DX group. Future studies should evaluate more chronic effects of proprietary pre-workout blends on total training volume and performance outcomes. Acknowledgements This Study was supported by Dymatize Nutrition.”
“Background Protein timing is a popular dietary strategy designed to optimize the adaptive response to exercise [1]. The strategy involves consuming protein in and around a training session in an effort to facilitate muscular repair and remodeling, and thereby enhance post-exercise strength- and hypertrophy-related adaptations [2]. It is generally accepted that protein should be consumed just before and/or immediately following a training session to take maximum advantage of a limited anabolic window [3]. Proponents of the strategy claim that, when properly executed, precise intake of protein in the peri-workout period can augment increases in fat-free mass [4].

These results are of extreme importance

as this route of phage administration can provide a viable strategy for delivery of phage in a commercial context. Phages could also be given in 3-deazaneplanocin A nmr the drinking water, however preliminary experiments showed that phage needed to be administrated with antacid and this could prove more difficult to deliver with the water than as an inclusion in the feed. Moreover, in our study the phage cocktail was administered as a single dose to Campylobacter-infected chicks 7dpi. A single dose of phage is, in comparison to multiple doses [41], an easier and more feasible strategy in a farm situation. It must be noted that the present model does not comprise all the variables that can play a role in the use of phages to control Campylobacter in poultry. Firstly, this model considers the use of phages as a therapy and not as a prophylactic measure. Secondly, in the

present work birds were challenged with Campylobacter at one-year-old, but in a real commercial context birds just get colonized with Campylobacter Bafilomycin A1 after two weeks of age. However, these conditions were not tested in our experiments as it is very difficult to maintain chicks free of pathogens. An additional limitation of the model was the limited time course of the experiments (seven days). Nevertheless, the model described herein is a proof of principle that Campylobacter phages given orally or administered in feed can effectively reduce the Campylobacter colonization levels. Further studies need to be undertaken in order to test phage Phosphoprotein phosphatase effectiveness in older chickens, their use as prophylactic agents and longer time course trials in order to reflect the JNJ-26481585 ic50 production cycle. Conclusions The phage cocktail was able to reduce C. coli and C. jejuni in infected poultry by approximately 2 log10cfu/g, which is of great importance as they are the most prevalent Campylobacter species found in positive

Campylobacter flocks. Moreover mathematical models indicate that a 2 log10cfu/g reduction of Campylobacter on the chicken carcasses could lead to a 30-fold reduction in the incidence of campylobacteriosis associated with consumption of chicken meals [48]. The phage cocktail administered in feed led to an earlier reduction in Campylobacter titre than when given by oral gavage and thus this method can be easily and successfully used under commercial condition in a poultry unit. Another important aspect of the present study is that as the phages that composed the cocktail were isolated from poultry carcasses, their use to reduce Campylobacter colonisation in the live birds would not introduce any new biological entity into the food chain. Methods Bacterial strains For the single-step growth experiments, two wild type strains of C. coli, isolated from poultry and poultry products, were used as the hosts of the three phages that composed the cocktail (C.

hominissuis of serotypes 6 and 8 isolated from pigs and environment. Vet Microbiol 2004, 102:227–236.PubMedCrossRef 3. van Ingen J, Boeree MJ, Dekhuijzen PNR, van Soolingen D: Environmental sources of rapid growing nontuberculous mycobacteria causing disease in humans. Clin Microbiol Infect 2009, 15:888–893.PubMedCrossRef 4. Salah IB, Ghigo E, Drancourt M: Free-living amoebae, a training field for macrophage GS-1101 mouse resistance of mycobacteria. Clin Microbiol Infect 2009, 15:894–905.PubMedCrossRef 5. McGrath EE, McCabe J, Anderson PB: Guidelines on the diagnosis and treatment of pulmonary non-tuberculous mycobacteria infection. Int J Clin Pract 2008, 62:1947–1955.PubMedCrossRef

6. Cassidy PM, Hedberg K, RG7112 mw Saulson A, McNelly E, Winthrop KL: Nontuberculous mycobacterial disease prevalence and risk factors: A changing epidemiology. Clin Infect Dis 2009, 49:e124-e129.PubMedCrossRef 7. Alvarez-Uria ROCK inhibitor G: Lung disease caused by

nontuberculous mycobacteria. Current Opinion in Pulmonary Medicine 2010, 16:251–256.PubMed 8. Mijs W, de Haas P, Rossau R, Van Der Laan T, Rigouts L, Portaels F, van Soolingen D: Molecular evidence to support a proposal to reserve the designation Mycobacterium avium subsp. avium for bird-type isolates and ‘M. avium subsp. hominissuis’ for the human/porcine type of M. avium. Int J Syst Evol Microbiol 2002, 52:1505–1518.PubMedCrossRef 9. Harriff MJ, Danelishvili L, Wu M, Wilder C, McNamara M, Kent ML, Bermudez LE: Mycobacterium avium genes MAV-5138 and MAV-3679 are transcriptional regulators that play a role in invasion of epithelial cells, in part by their regulation Aspartate of CipA, a putative surface protein interacting with host cell signaling pathways. J Bacteriol 2009, 191:1132–1142.PubMedCrossRef 10. Salomé Gomes M, Fernandes SS, Cordeiro JV, Gomes SS, Vieira A, Appelberg R: Engagement of Toll-like receptor 2 in mouse macrophages infected with Mycobacterium avium induces non-oxidative and TNF-independent anti-mycobacterial activity. Eur J Immunol 2008, 38:2180–2189.PubMedCrossRef 11. Shiratsuchi

H, Ellner JJ: Expression of IL-18 by Mycobacterium avium-infected human monocytes; association with M. avium virulence. Clin Exp Immunol 2001, 123:203–209.PubMedCrossRef 12. Bermudez LE, Young LS, Enkel H: Interaction of Mycobacterium avium complex with human macrophages: Roles of membrane receptors and serum proteins. Infect Immun 1991, 59:1697–1702.PubMed 13. Rao SP, Ogata K, Catanzaro A: Mycobacterium avium-M. intracellulare binds to the integrin receptor alpha v beta 3 on human monocytes and monocyte-derived macrophages. Infect Immun 1993, 61:663–670.PubMed 14. Roecklein JA, Swartz RP, Yeager H Jr: Nonopsonic uptake of Mycobacterium avium complex by human monocytes and alveolar macrophages. Journal of Laboratory and Clinical Medicine 1992, 119:772–781.PubMed 15.

CrossRefPubMed 12. Steinberg GD, Brendler CB, Squire RA, Isaacs JT: Experimental intravesical therapy for superficial transitional cell OICR-9429 molecular weight carcinoma in a rat bladder tumor model (J). J Urol 1991, 145 (3) : 647–653.PubMed 13. Matsuki T, Watanabe K, Tanaka R: Genus- and species-specific

PCR primers for the detection and identification of bifidobacteria. Curr Issues Intest Microbiol 2003, 4: 61–69.PubMed 14. Haarman M, Knol J: Quantitative real-time PCR assays to identify and quantify fecal Bifidobacterium species in infants receiving a prebiotic infant formula. Appl Environ Microbiol 2005, 71: 2318–2324.CrossRefPubMed 15. Masco L, Huys G, Gevers D, Verbrugghen L, Swings J: Identification of Bifidobacterium species using rep-PCR fingerprinting. Syst Target Selective Inhibitor Library screening Appl Microbiol 2003, 26 (4) : 557–563.CrossRefPubMed 16. Yi C, Huang Y, Guo ZY, Wang SR: Antitumor effect of cytosine deaminase/5-fluorocytosine suicide gene therapy system mediated by Bifidobacterium infantis on melanoma. Acta Pharmacol Sin 2005, 26 (5) : 629–634.CrossRefPubMed 17. Requena T, Burton J, Matsuki T, Munro K, Simon MA, Tanaka R, Watanabe K, Tannock

GW: Identification, detection, and enumeration of human Tipifarnib Bifidobacterium species by PCR targeting the transaldolase gene. Appl Environ Microbiol 2002, 68: 2420–2427.CrossRefPubMed 18. Fujimori M, Amano J, Taniguchi S: The genus Bifidobacterium for cancer gene therapy. Curr Opin Drug Discov Devel 2002, 5 (2) : 200–203.PubMed 19. Satokari R, Grönroos T, Laitinen K, Salminen S, Isolauri E: Bifidobacterium and Lactobacillus DNA in the human placenta. Lett Appl Microbiol 2009, 48 (1) : 8–12.CrossRefPubMed 20. Ventura M, Reniero R, Zink R: Specific identification and targeted characterization of Bifidobacterium lactis from different environmental isolates by a combined multiplex-PCR approach. Appl Environ Microbiol 2001, 67: 2760–2765.CrossRefPubMed 21. Michl P, Gress TM: Bacteria and bacterial toxins as therapeutic

agents for solid tumors. Curr Cancer Drug Targets 2004, 4: 689–702.CrossRefPubMed Competing interests The authors declare that they have no competing Dimethyl sulfoxide interests. Authors’ contributions WT, YH, SZ, YM, GL carried out the experiments described in the study. The Bifidobacterium infantis -mediated TK/GCV suicide gene therapy system is constructed by WT and YH. Bacterial strains and cultivation is finished by SZ and GL. Experimental of rat model finished by YM and WT. Apoptosis and Immunohistochemical is finished by WT and YH. Statistical analysis is finished by WT and YH. All authors read and approved the final manuscript.”
“Background Lewis y antigen is carried by glycoconjugates (glycoproteins and glycolipids) at cell surface.

coli strains again revealed synergism between lacticin 3147 and the polymyxins. An FIC index value of 0.248 was obtained when lacticin

3147 and polymyxin B were combined against 0157:H- while the corresponding lacticin 3147 and polymyxin E FIC value was 0.188. When lacticin 3147 and polymyxin B were combined against E. coli DH5α and EC101, FIC indices of 0.188 and 0.5 were obtained, respectively. In addition, an FIC index of 0.188 was determined when lacticin 3147 and polymyxin E were combined for these two target strains. A number of additional assays were carried out in order to determine if the benefits of combining lacticin 3147 and the check details polymyxins in broth extended to Gram positive targets. For this purpose Bacillus cereus 8079, Enterococcus faecium DO and Staphylococcus aureus 5247 were selected as representative selleck inhibitor indicator strains. It was established that, while some partial synergy between lacticin 3147 and polymyxin B was observed with respect to B. cereus 8079 and S. aureus 5247 (FIC = 0.62 and 0.75, respectively), the other combinations resulted in an additive or indifferent outcome. Given that the most notable outcome from the study was the synergistic activity of lacticin 3147 and the polymyxins against some Gram negative targets, further investigations were carried out to determine how the respective

components of lacticin 3147, i.e. Ltnα and Ltnβ, perform individually in the presence of polymyxin B/E. Selecting the sensitive strain E. coli 0157:H- as a target, we were able to evaluate the contribution Chloroambucil of the individual α and β peptides to this phenomenon (Table 2). Taking into consideration the molecular weights and 1:1 ratio at which α and β are combined, we can derive the relative amount (μg/ml) of each individual peptide present when lacticin 3147 (Ltnα and Ltnβ combined in a 1:1 ratio) is synergistic with polymyxin B/E. With this information we can click here compare the action of α and β alone to the same amount of each peptide present in whole lacticin 3147 in each case of synergy. Although various degrees of synergy exist due to the different combinations and concentrations assessed, only those that yielded the greatest synergy with respect to

lacticin 3147 are listed in Table 1. Obtaining such a high degree of synergy was not possible with the single peptides, Ltnα and Ltnβ. For this reason additional synergy values/FIC data for lacticin 3147 in combination with polymyxin B and E has been included in Table 2. This provides a means by which the contribution of the individual lacticin 3147 components can be derived by focusing on a fixed level of polymyxin B/E in each case of synergy. Hence, it is apparent that, when combined with a set concentration of polymyxin B and E, 6 times more Ltnα alone is required to achieve the level of synergy obtained when both Ltnα and Ltnβ are present. In contrast, only 4.7 times Ltnβ alone is required to achieve a corresponding level of activity in the absence of Ltnα.

Tn5 mutagenesis and mapping A library of transposons selleck kinase inhibitor in YS1646 was made using the EZ::TN insertion kit from Epicentre (Madison, WI). Over 56,000 kanamycin resistant (KanR) clones of YS1646 were pooled. The pool was screened for mutation rate

and auxotrophy for different biosynthetic pathways by replica plating onto minimal media and media containing various pools of amino acids and bases [30]. Following selection for CO2 resistance by plating dilutions to LB-Kan and incubating in 5% CO2, the colonies were again pooled and a P22 lysate was generated and transduced to a non-suppressed strain and purified for kanamycin resistance under non-CO2 conditions in order to separate spontaneous mutants from Tn5-based suppressors. Transposon-associated Tn5 insertions were identified by replica plating in air and CO2. Mapping of the insertion sites was performed by using the GenomeWalker™ kit (Clonetech, Mountain View, CA) according

to the manufacture’s instructions. Construction of non-polar deletion in zwf A non-polar deletion in zwf was generated by constructing a pCVD442 vector capable of deleting the entire zwf coding region by homologous recombination with the Salmonella chromosome [10]. selleck screening library Primers for PCR were designed that would generate one product immediately upstream of the 5′ ATG start codon and a separate product immediately downstream of the 3′ stop codon of the zwf coding region. The two separate products could then be ligated sequentially into the pCVD442 vector. The primers were: zwf-5′-reverse: 5′-GTGTGAGCTCGTGGCTTCGCGCGCCAGCGG

CGTTCCAGC-3′ (with added SacI), zwf-5′-forward: 5′-GTGTGCATGCGGGGGG CCATATAGGCCGGGGATTTAAATGTCATTCTCCTTAGTTAATCTCCTGG-3′ (with added SphI), zwf-3′ reverse: 5′-GTGTGCATGCGGGGTTAATTAA GGGGGCGGCCGCATTTGCCACTCACTCTTAGGTGG-3′, and zwf-3′-forward: 5′-GTGTGTCGACCCTCGCGCAGCGGCGCATCCGGATGC-3′). The primers also oxyclozanide generate internal NotI, PacI, SphI, SfiI, and SwaI in order to facilitate cloning of DNA fragments into the Δzwf for stable chromosomal integration without antibiotic resistance. This vector is referred to as pCVD442-Δzwf. The presence of the deletion, in AmpS SucR colonies, was detected by PCR using the following primers:zwf-FL-forward: 5′-ATATTACTCCTGGCGACTGC-3′ and zwf-FL-reverse: Selleckchem 10058-F4 5′-CGACAATACGCTGTGTTACG-3′. Wild type produces a 2,026 base pair product whereas the mutant produces a 608 base pair (bp) product, a difference of 1418 bp, which corresponds to the size of the zwf gene (1475 bp minus a 57 bp multiple cloning site that replaces the open reading frame). β-galactosidase Assay For β-galactosidase expression, lacZ was cloned into the high copy vector pSP72 (Promega) in E. coli, transformed into Salmonella strains (via restriction defective Salmonella strain YS501 [31], and screened for bright blue colonies on LB agar containing 40 μg/ml X-gal. lacZ was cloned from E. coli K-12 MG1655 [32] obtained from the Yale E.

noninfected cells. Results are means plus standard deviation for all 5 donors. LM: L. monocytogenes EGDe, SA: S. aureus, SP: S. pneumoniae. Selleck Sepantronium Discussion Using whole-genome based microarray analysis we were able to detect the transcriptional upregulation

or repression of a robust minimal set of genes in infected cells compared to untreated controls even within the short interval of one hour. Despite donor-specific gene variations and despite varying invasion strategies of the studied bacteria we identified a common program of gene expression induced by all three bacterial pathogens. Linsitinib clinical trial Remarkably, global comparison of the expression profiles already hinted at gross similarities by the infection among the pathogens (Figure 1, Tables 1, 2). For example, the clustering suggested that the global response of LM and SA are more similar to each other while SP infection generates a different and more subdued response pointing to similarities in the virulence of both LM XMU-MP-1 datasheet and SA. One assumption may be that they generate similar responses because of their intracellular nature. However after one hour of infection we observed only a

few internalized bacteria (data not shown) suggesting that secreted bacterial factors, a common feature between L. monocytogenes and S. aureus are important inducers of the response observed. LM expresses a cholesterol-dependent cytolysin (CDC) listeriolysin, that is crucial for gaining entry to the cytosol while SA encodes for several haemolysins and cytolysins e.g. the two secretory haemolysins α and β [12]. SP, on the other hand, are generally encapsulated bacteria with the capsule effectively preventing ingestion of the bacteria by the monocyte. This nearly creates a physical barrier between the bacteria and the host cell and could underlie the observations on host gene expression made

here. The similarity between pneumococcal and LM-induced gene expression could be due to the cellular response to CDC-type toxins produced by these bacteria [12]. Nevertheless, there were clear differences in the number of detectable differentially regulated genes as well, with fewer genes being differentially expressed on infection with SP. This might point to an as yet unknown mechanism for subduing the host response by SP or it might indicate the improved immune evasion ability of this particular capsular SP strain. Remarkably, hallmark inflammatory cytokines, e.g. TNF and IL1 were not part of the common response of the monocytes. However, the most prominent feature of the common genes set is the upregulation of interleukin 23A (IL23, p19) mRNA. Thus it seems that in naive human monocytes gram-positive bacteria induce the transcription of IL23 as the first major systemic proinflammatory cytokine, reminiscent of the effects of Mycobacteria and Salmonellae [13, 14].