aeruginosa. The wild-type and mioC mutant strains of P. aeruginosa PAO1 were purchased from Washington University Genome Center. Antibiotics (tetracycline, 20 μg mL−1; kanamycin, 100 μg mL−1) were added where necessary. The open reading frames of the mioC genes for the mioC over-expressed complementation stain were

PCR-amplified using PAmioC-OE F (CGCAAGCTTAATGCCCGGCTTACCCCTGTTG)/PAmioC-OE R (CGCGGATCCCGTTATTCGCCCTACCGCTTGTCC) primer pairs. The amplified mioC gene fragments were cloned into the HindIII/BamHI sites of pBBR1MCS-2 to yield pBBR1-mioC. The pBBR1-mioC was transformed into E. coli Top10 via electroporation. Small Molecule Compound Library Escherichia coli Top10 cells were grown with aeration at 37 °C in lysogeny broth (LB) medium supplemented with kanamycin (100 μg mL−1). The cells were harvested and pBBR1-mioC isolated using Idasanutlin the MiniPrep plasmid purification kit (Takara). pBBR1-mioC was transformed into P. aeruginosa mioC mutant cell via electroporation. In the cases of the growth and lysis curves, cells were cultured with LB medium at 37 °C with aeration. The cell-free supernatants (CFS) were prepared by filtering a culture of each tested strain through a 0.22-mm pore-size filter (Sartorius). All chemicals were acquired from Sigma (Sigma Chemical, St. Louis, MO) unless otherwise stated. Twenty 96-well PM plates (Biolog Co.) were used

with the following nomenclature: metabolic panels, PM1–PM10; sensitivity panels, PM11–PM20. PM experiments were conducted according to the manufacturer’s

instruction. The cells were inoculated into the PM plates and incubated at 37 °C for 48 h. Cell growth was reflected by the development of purple coloration as monitored and recorded by OmniLog PM Station and PM Kinetic (Biolog). Nintedanib (BIBF 1120) Further information on the compounds tested with the PM kit can be found at the Biolog website. The wild-type, mioC mutant and the mioC over-expressed complementation cells were grown overnight in LB medium and diluted 100-fold with fresh LB medium with vigorous aeration. After the cells reached exponential phase (OD600 nm ~ 0.5), serially diluted cells were spotted on LB agar with paraquat, hydrogen peroxide (H2O2), cumen hydroperoxide (CHP), ampicillin (Amp), gentamicin (Gm), norfloxacin (Nor), 2, 2′-dipyridyl, arsenic (As), zinc (Zn), and copper (Cu). Spotted LB agar plates were grown at 37 °C for 1 day. Polystyrene 96-well microtiter plates (BD Biosciences, San Jose, CA) were utilized as abiotic surfaces for biofilm formation study. Bacterial cultures were grown overnight, washed twice in phosphate-buffered saline and inoculated at 106 CFU mL−1 in LB broth with a variety of substrates. After 48 h of incubation at 30 °C, biofilm formation was determined via crystal violet staining and quantified by measuring the absorbance at 595 nm, normalized by the absorbance at 600 nm (Lee et al., 2010).