The suspension was centrifuged and washed twice with PBS. Cells were left to adhere in serum-free RPMI 1640 for 40 min. Nonadherent cells were washed away. Ninety-five

percent of the remaining adherent cells were TAMs as assessed by morphology and macrophage specific marker CD68 positivity. Immunofluorescence TAMs were adhered to 24-well plate , fixed in 4% paraformaldehyde at room temperature for 5 minutes, washed with PBS twice, incubated with 1% BSA at 37°C for 30 minutes to block nonspecific interactions, and then stained with primary antibodies to CD68 (1:100 dilution, sc-20060, Santa Cruz Biotechnology, CA, USA) at 4°C overnight. After several washes with PBS, the cells were incubated in Selleck Ro 61-8048 an appropriate, rhodamine-labeled goat anti-mouse secondary antibody(Proteintech Group, Inc, Chicago ,USA) at room

temperature for 1 h. Nuclei of all cells were then stained with 4’6-diamidino-2-phenylindole(DAPI). SP600125 order Image was taken at 200 × magnification on an Olympus-IX51 microscope. For each patient, 10 fields were imaged and measured for percentage of macrophage (CD68 positive cells/DAPI stained cells). Immunofluorescence was repeated in three randomly selected patients. Preparation normal macrophage Macrophage (Mφ) was obtained as described previously [20]. In brief, the mononuclear cells were isolated from peripheral blood matched with TAMs by Ficoll-Hypaque density gradient centrifugation (density, 1.077 ± 0.001 g/ml, Axis-Shield, Oslo, Norway) at 450 × g for 30 min at room temperature. The mononuclear cells were washed thrice with PBS and plated at 1 × 107 in 6-cm PRKD3 tissue culture dishe for 2 h in DMEM alone.

Thereafter, the nonadherent cells were washed thrice with warm PBS and the adherent monocytes were cultured in DMEM containing 5% FBS and 25 ng/ml human macrophage colony-stimulating factor((rhM-CSF, PeproTech, Rocky Hill, NJ, USA), The medium was changed every 2 days, and macrophage were obtained after 6 days in vitro cultivation. RNA isolation and Quantitative real-time RT-PCR(QRT-PCR) Total RNA was isolated from TAMs and their matched macrophages by using RNeasy Mini Kit (Qiagen, Valencia, CA, USA) as described by the manufacturer’s Transmembrane Transporters inhibitor protocol. For mRNA analysis, an aliquot containing 2 μg of total RNA was transcribed reversely using M-MLV reverse transcriptase (Promega, Madison, WI, USA). Specific primers (Genery, Shanghai, China) were used to amplify cDNA. QRT-PCR was done using SYBR Green PCR master mix (Applied Biosystems, Piscataway, NJ, USA). The primers for QRT-PCR were: β-actin forward (F) 5′ ACCACA CCTTCTACAATGA3′, β-actin reverse(R) 5′GTCATCTTCTCGCGGTTG3′; IL-10 F 5′ AGAACCT GAAGACCCTCAGGC3′, IL-10 R 5′ CCACGGCCTTGCTCTTGTT 3′; cathepsin B F 5′ TGCA GCGCTGGGTGGATCTA 3′; cathepsin B R 5′ ATTGGCCAACACCAGCAGGC 3′; cathepsin S F 5′ GCTTCTCTTGGT GTCCATAC 3′, cathepsin S R 5′ CATTACTGCGGGAATGAGAC 3′.