Opt Mater 2002, 20:189–196.CrossRef 29. Ilyas M, Zulfequar M, Khan ZH, Husain M: Optical band gap and optical constants in a-Ga x Te 100-x thin films. Opt Mater 1998, 11:67–77.CrossRef 30. Abd-Elrahman MI, Khafagy RM, Zaki SA, Hafiz MM: Effect of composition on the optical constants of Se 100e x Te x thin films. J Alloys and Compds 2013, 571:118.CrossRef

31. El-Zahed H, Khaled MA, El-Korashy A, Youssef Selleck SCH727965 SM, El Ocker M: Dependence of optical band gap on the compositions of Se (1-x) Te x thin films. Solid State Commun 1994, 89:1013.CrossRef 32. Mott NF, Davis EA: Electronics Processes in Non-crystalline Materials. Oxford: Clarendon; 1979:428. 33. Theye ML: Proc Vth International Conference on Amorphous and Liquid Semiconductors. 1973, 1:479. 34. Agarwal P, Goel S, Rai JSP, Kumar A: Calorimetric studies in glassy Se 80- x Te 20 In x . Physica Status Solidi (A) 1991, 127:363.CrossRef 35. Khan ZH, Khan SA, Salah N, Habib S: Effect of composition on electrical and optical properties of thin films of amorphous Ga x Se 100-x nanorods. Nanoscale Res Letters 2010, 5:1512.CrossRef 36. Khan ZH: Glass transition kinetics in ball milled amorphous Ga x Te 100-x nanoparticles. J Non-Cryst Solids 2013, 380:109.CrossRef 37.

Khan ZH, Salah N, Habib SS: Electrical transport of a-Se 87 Te 13 nanorods. J Expt Nanosci 2011, 6:337.CrossRef Saracatinib price 38. Khan ZH, Al-Ghamdi AA, Khan SA, Habib S, Salah N: Morphology and optical properties of thin films of a-Ga x Se 100-x nanoparticles. Nanoscci Nanotech Letts 2011, 3:1.CrossRef 39. Khan ZH, Zulfequar M, Sharma TP, Husain M: Optical properties of a-Se 80-x Ga 20 Sb x thin films. J Opt Mater 1996, 6:139.CrossRef Competing interests The author declares no competing interests.”
“Background Nanomaterials are nanometer-sized materials with specific physicochemical properties that are different from those of micromaterials of the same composition. In recent

years, as nanotechnology and www.selleck.co.jp/products/abt-199.html materials science have progressed, engineered nanomaterials have been mass produced and buy AZD2014 widely applied. They are now routinely used as coating materials, cosmetic pesticides, and medications [1, 2]. This means people are increasingly exposed to various kinds of manufactured nanoparticles in production and daily life. While nanomaterials provide benefits to diverse scientific fields, they also pose potential risks to the environment and to human health [3, 4]. However, most studies have focused on the effects of one single type of particle or several particle types of the same substance, for example, nanoparticles and carbon nanotubes (CNTs) as carbonaceous nanomaterials. Rare studies have compared the toxicological effects of different types of nanomaterials, including carbonaceous, siliceous, and metal oxide nanoparticles.

Curr Opin Microbiol 2005, 8:10–15.CrossRefPubMed 9. Chakravortty D, Hansen-Wester I, Hensel M: Salmonella pathogenicity island 2 mediates protection of intracellular Salmonella from reactive nitrogen intermediates. J Exp Med 2002, 195:1155–1166.CrossRefPubMed 10. Zhang S, Adams LG, Nunes J, Khare S, Tsolis RM, Bäumler AJ: Secreted effector proteins of Salmonella enterica serotype typhimurium elicit host-specific chemokine profiles in animal models of typhoid fever and enterocolitis. Infect Immun 2003, 71:4795–803.CrossRefPubMed 11. Ganz T: Defensins: antimicrobial peptides of innate immunity. Nat Rev Immunol 2003,

3:710–720.CrossRefPubMed 12. Evans EW, Beach FG, Moore KM, Jackwood MW, Glisson JR, Harmon BG: Antimicrobial activity GSK126 clinical trial of chicken and turkey heterophil peptides CHP1, CHP2, THP1, and THP3. Vet Microbiol 1995, 47:295–303.CrossRefPubMed Seliciclib mouse 13. Klüver E, Schulz-Maronde S, Scheid S, Meyer B, Forssmann WG, Adermann K: Structure-activity relation of human beta-defensin 3: influence of disulfide

bonds and cysteine substitution on antimicrobial activity and cytotoxicity. Biochemistry 2005, 44:9804–9816.CrossRefPubMed 14. Lehrer RI, Barton A, Daher KA, Harwig SS, Ganz T, Selsted ME: Interaction of human defensins with Escherichia coli. Mechanism of bactericidal activity. J Clin Invest 1989, 84:553–561.CrossRefPubMed 15. Harwig SSL, Swiderek KM, Kokryakov VN, Tan L, Lee TD, Panyutich EA, Aleshina GM, Shamova OV, Lehrer RI: Gallinacins: cysteine-rich antimicrobial peptides of chicken leukocytes. FEBS Lett 1994, 342:281–285.CrossRefPubMed 16. Lynn DJ, Higgs R, Gaines S, Tierney J, James T, Lloyd AT, et al.: Bioinformatic discovery and initial characterisation of nine novel antimicrobial peptide genes in the chicken. Immunogenetics 2004, 56:170–177.CrossRefPubMed 17. Lynn DJ, Higgs R, Lloyd AT, O’Farrelly C, Herve-Grepinet V, Nys Y, et Fluorometholone Acetate al.: Avian beta-defensin nomenclature: a community proposed update. Immunol Lett 2007, 110:86–89.CrossRefPubMed 18. Xiao Y, Hughes

AL, Ando J, Matsuda Y, Cheng JF, Skinner-Noble D, et al.: A genome-wide screen identifies a single beta-defensin gene cluster in the chicken: implications for the origin and evolution of mammalian defensins. BMC Genomics 2004, 5:56.CrossRefPubMed 19. Hasenstein JR, Zhang G, Lamont SJ: selleck chemicals Analyses of Five gallinacin genes and the Salmonella enterica serovar Enteritidis response in poultry. Infect Immun 2006, 74:3375–3380.CrossRefPubMed 20. Sadeyen JR, Trotereau J, Velge P, Marly J, Beaumont C, Barrow PA, et al.: Salmonella carrier state in chicken: comparison of expression of immune response genes between susceptible and resistant animals. Microbes Infect 2004, 6:1278–1286.CrossRefPubMed 21. Sadeyen JR, Trotereau J, Protais J, Beaumont C, Sellier N, Salvat G, et al.: Salmonella carrier-state in hens: study of host resistance by a gene expression approach. Microbes Infect 2006, 8:1308–1314.CrossRefPubMed 22.

pneumoniae and the rgg gene for S. oralis[24–26]. In the current study, the gene expression of S. pseudopneumoniae is determined and compared with those of S. pneumoniae KCTC 5080T S. mitis KCTC 3556T and S. oralis KCTC 13048T by in silico analysis and by in vitro transcriptome microarrays experiments using open reading frame (ORF) microarrays of Streptococcus pneumoniae R6 (GenBank accession number NC_003098) platform. Results and discussion Statistical analysis of microarray experiments We compared the expression profiles by hybridization to the immobilized probes on the microarray of S. pneumoniae TIGR4: NC_003028 with the total RNA of S. oralis KCTC 13048T, S. mitis KCTC

3556T, and S. pseudopneumoniae CCUG 49455T. Total RNA from the strains S. pneumoniae KCTC 5080T, S. mitis KCTC 3556T,

S. oralis KCTC 13048T, and S. pseudopneumoniae CCUG 49455T was hybridized to NimbleGen selleck products S. pneumoniae TIGR4: NC_003028 Gene Expression 4x72K microarrays. Each array contains 4 sets of strains, and each strain was compared with each other strains. Interarray correlation values (Range: -1 ≤ r ≤ 1) are shown in the upper right panels and pairwise scatter plots of gene expression values (log2) are shown in the lower left panels (Figure 1). A correlation value close to 1 shows high similarity between BI 2536 samples. This correlation value between strains S. oralis-S. mitis was 0.609, S. oralis-S. pneumoniae was 0.365, CB-839 supplier S. oralis-S. pseudopneumoniae was 0.375, S. mitis-S. pneumoniae was 0.438, S. mitis-S. pseudopneumoniae was 0.536 and S. pneumoniae-S. pseudopneumoniae was 0.499. Figure 1 Reproducibility and dynamic range with pairwise scatter plots. Four technical replicates of Streptococcus pseudopneumoniae, DNA ligase Streptococcus pneumoniae, Streptococcus mitis, and Streptococcus oralis RNA were hybridized to NimbleGen Streptococcus pneumoniae R6 Gene Expression 4x72K microarrays. Interarray correlation values (Range:

-1 ≤ r ≤ 1) are shown in the upper right panels and pairwise scatter plots of gene expression values (log2) are shown in the lower left panels. So, S. oralis; Sm, S. mitis; Spp, S. pseudopneumoniae; Sp: S. pneumoniae Phylogenetic relatedness between streptococcal species Based on their overall genomic profiles, there was clear delineation between each Streptococcus species. The hierarchical clustering analysis from a normalized signal grouped the isolates mainly according to their phylogenetic relationship between each Streptococcus species. The clustering of S. mitis, S. oralis and S. pneumoniae, S. pseudopneumoniae strains showed two distinct branches, placing them in two separate clades that clearly differentiated each species group (Figure 2). The map shows the expression levels of the 1,123 probes (Figure 3). A total of 444 genes were upregulated (red) and 484 genes were downregulated(green) in S. oralis KCTC 13048T, 470 genes were upregulated (red) and 443 genes were downregulated (green) in S.

Recent data from the Dialysis Outcomes and Practice Patterns Study II (DOPPS II) showed that prescription of antihypertensive agent classes varied significantly by country, ranging for beta blockers from 9.7% in Japan to 52.7% in Sweden, for ARBs from 5.5% in

Italy to 21.3% in Japan, CYT387 and for CCBs from 19.5% in Belgium to 51.4% in Japan [29]. Therefore, the high proportion of prescribed CCBs and ARBs in the present study in Japan is not so surprising. The ability to generalize the results of this study may be limited because of the number of patients and clinical characteristics. The number of patients was too small to conclude prognosis of a large variety and complexity of HD patients. Patients included in this study were all hypertensive and were treated with one or more antihypertensive agents. Furthermore, almost all patients were in good health. Recently, diurnal BP variation has been considered important [30]. In the present study, ambulatory BPs were not measured. Ambulatory BP monitoring provides not only static but also dynamic information about BP that should be considered to ensure effective management of hypertension and CV diseases. In conclusion, the results of the present Selleckchem INCB28060 study are: (1) predialysis systolic BPs were not correlated with any home BPs; (2) LVMI had a significant positive correlation with home BPs, especially Semaxanib ic50 morning systolic BPs on HD and non-HD days; and (3) home BPs, especially systolic BPs in

the morning on HD days, were significant predictors of CV events during the follow-up period. Prospective intervention studies with large numbers of patients will be needed to clarify the cause–effect relationship between various BPs and CV events. Conflict of interest All the authors declare no competing interests. Open Access This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction

in any medium, provided the original learn more author(s) and source are credited. References 1. Tomita J, Kimura G, Inoue T, Inenaga T, Sanai T, Kawano Y, et al. Role of systolic BP in determining prognosis of hemodialyzed patients. Am J Kidney Dis. 1995;25:405–12.PubMedCrossRef 2. Salem MM. Hypertension in the hemodialysis population: a survey of 649 patients. Am J Kidney Dis. 1995;26:461–8.PubMedCrossRef 3. Mittal SK, Kowalski E, Trenkle J, McDonough B, Halinski D, Devlin K, et al. Prevalence of hypertension in a hemodialysis population. Clin Nephrol. 1999;51:77–82.PubMed 4. Grekas D, Bamichas G, Bacharaki D, Goutzaridis N, Kasimatis E, Tourkantonis A. Hypertension in chronic hemodialysis patients: current view on pathophysiology and treatment. Clin Nephrol. 2000;53:164–8.PubMed 5. Rocco MV, Yan G, Heyka RJ, Benz R, Cheung AK, HEMO Study Group. Risk factors for hypertension in chronic hemodialysis patients: Baseline data from the HEMO study. Am J Nephrol. 2001;21:280–8.PubMedCrossRef 6.

37 Human Brazil – - – N   *CBS 400.67 Soil Brazil – - – N   *CBS 281.35 Human USA – - – N   *CBS 220.97 Linden tree USA – - – N   *CBS

840.69 Decaying timber Finland – - – N   *CBS 221.97 Unknown Uruguay + – - F   *CBS 223.97 Human USA + – - F   *: P. americana, +: with insertion, -: no insertion, na: not analized. Table 2 List of ITS, 28S rDNA and intron sequences of P. verrucosa Sample ID or entry name Length (bp) Splice positions Accession number   ITS 28S Intron-F Intron-G Intron-H position a position b   PV1 535 4130           AB550775 PV2 535 3922           AB550776 PV3 535 4133           AB550777 PV41

selleckchem 534 3922           AB550778 Yao 535 3349           AB550779 F-PV1     391     924 798   F-PV2     391     924 798   F-PV3     391     924 798   F-PV41     391     924 798   G-PV1       390   2239 1921   G-PV3       393   2239 1921   F-TH9     389     924 798 AB550780 F-PV28     389     924 798 AB550781 F-TH31     389     924 798 AB550782 F-TH35     389     924 798 AB550783 F-PV33     390     924 798 AB550784 F-PV34     390     924 798 AB550785 G-PV33       389   2239 1921 AB550786 G-PV34       389   2239 1921 AB550787 H-PV28         403 Nutlin 3 2905 2563 AB611046 a click here Position means relative to the 28S rRNA of P. verrucosa Yao strain and b position means relative to 23S rRNA of E. coli J01965. Table 3 Primers used for the amplification and sequencing of P. verrucosa Primer Sequence (5′-3′) 5′ position* Source 5′ position including ITS ITS1 TCCGTAGGTGAACCTGCGG -563 White TJ, et al. [48] 1 ITS3 GCATCGATGAAGAACGCAGC

-309 White TJ, et al. [48] 255 NL1 GCATATCAATAAGCGGAGGAAA 39 O’Donnell K [49] 603 3PV26 CCGTCTTGAAACACGGACC 633 This work 1197 inFG-F CCGAAAGATGGTGAACTATGCC 795 This work 1359 inF-F ACGTGCAAATCGATCGTCAA 868 This work 1432 inF-R CAAGGCCTCTAATCATTCGCT 1009 This work 1573 8PV26 GAACCTTTCCCCACTTCAG 1487 This work 2051 11PV26 AAGCCATAGGGAAGTTCCGT 1525 This work 2089 9PV26 GTCGTACTCATAACCGCAG 1818 This work 2382 mTOR inhibitor CA-INT-L ATAAGGGAAGTCGGCAAAATAGATCCGTAA 1881 McCullough MJ, et al. [50] 2445 2PV26 TCCCGAAGTTACGGATCTA 1918 This work 2482 16PV26 CCCAACCCTTAGAGCCAATC 1942 This work 2506 10PV26 CCGTACCAGTTCTAAGTTG 2089 This work 2653 inG-F GATGGCCAGAAAGTGGTGTTG 2130 This work 2694 inG-R TAGGGACAGTGGGAATCTCGT 2314 This work 2878 26S-INT3 CTAGCGAAACCACAGCCAAG 2323 This work 2887 CA-INT-R CCTTGGCTGTGGTTTCGCTAGATAGTAGAT 2343 McCullough MJ, et al.

Significantly lower levels of IgA-coated bacteria were detected in faecal samples of untreated and treated CD patients when compared to healthy controls. It can be speculate that these results could reflect the existence of a barrier defect in CD patients, which fails to stabilise the gut microbiota and prevent the host from the invasion of harmful antigens and pathogens. In addition, treated CD patients showed lower levels of IgG and IgM coated bacteria. In contrast, IBD patients displayed a higher {Selleck Anti-cancer Compound Library|Selleck Anticancer Compound Library|Selleck Anti-cancer Compound Library|Selleck Anticancer Compound Library|Selleckchem Anti-cancer Compound Library|Selleckchem Anticancer Compound Library|Selleckchem Anti-cancer Compound Library|Selleckchem Anticancer Compound Library|Anti-cancer Compound Library|Anticancer Compound Library|Anti-cancer Compound Library|Anticancer Compound Library|Anti-cancer Compound Library|Anticancer Compound Library|Anti-cancer Compound Library|Anticancer Compound Library|Anti-cancer Compound Library|Anticancer Compound Library|Anti-cancer Compound Library|Anticancer Compound Library|Anti-cancer Compound Library|Anticancer Compound Library|Anti-cancer Compound Library|Anticancer Compound Library|Anti-cancer Compound Library|Anticancer Compound Library|buy Anti-cancer Compound Library|Anti-cancer Compound Library ic50|Anti-cancer Compound Library price|Anti-cancer Compound Library cost|Anti-cancer Compound Library solubility dmso|Anti-cancer Compound Library purchase|Anti-cancer Compound Library manufacturer|Anti-cancer Compound Library research buy|Anti-cancer Compound Library order|Anti-cancer Compound Library mouse|Anti-cancer Compound Library chemical structure|Anti-cancer Compound Library mw|Anti-cancer Compound Library molecular weight|Anti-cancer Compound Library datasheet|Anti-cancer Compound Library supplier|Anti-cancer Compound Library in vitro|Anti-cancer Compound Library cell line|Anti-cancer Compound Library concentration|Anti-cancer Compound Library nmr|Anti-cancer Compound Library in vivo|Anti-cancer Compound Library clinical trial|Anti-cancer Compound Library cell assay|Anti-cancer Compound Library screening|Anti-cancer Compound Library high throughput|buy Anticancer Compound Library|Anticancer Compound Library ic50|Anticancer Compound Library price|Anticancer Compound Library cost|Anticancer Compound Library solubility dmso|Anticancer Compound Library purchase|Anticancer Compound Library manufacturer|Anticancer Compound Library research buy|Anticancer Compound Library order|Anticancer Compound Library chemical structure|Anticancer Compound Library datasheet|Anticancer Compound Library supplier|Anticancer Compound Library in vitro|Anticancer Compound Library cell line|Anticancer Compound Library concentration|Anticancer Compound Library clinical trial|Anticancer Compound Library cell assay|Anticancer Compound Library screening|Anticancer Compound Library high throughput|Anti-cancer Compound high throughput screening| percentage of immunoglobulin-coated faecal bacteria in active disease and shortly after remission, supporting the concept that the

mucosal tolerance to the gut microbiota is deregulated in these patients [5]. A remarkable reduction in Gram-positive bacterial populations was characteristic of the active phase of the disease while its abundance was partially restored in patients under a GFD. In addition, a reduction in the ratio of Gram-positive to Gram-negative bacteria was found in the

patients regardless of the phase of the disorder. The levels of total Gram-positive bacteria were also lower in duodenal biopsies of patients with active and inactive CD than in controls, while the proportions of total Gram-negative bacteria were over-represented particularly in biopsies of active CD patients [12]. Therefore, the results obtained first in biopsies and now in faeces from children of the same Torin 2 age confirm similar structural changes in the composition of the gut microbiota associated with CD. The reductions in beneficial Gram-positive bacteria could favour the residence and interactions of harmful Gram-negative bacteria Etomoxir supplier within the mucosal surface of CD patients, Amylase thereby contributing to loss of gluten tolerance. Antigenic structures of Gram-negative bacteria such as flagellins and lipopolysaccharides have been related to the inflammatory responses and pathogenesis of IBD [14]. Shifts in the intestinal microbiota, characterized by increases in pro-inflammatory Gram-negative bacteria, have also been shown to aggravate murine colitis via activation of acute inflammation through Toll-like

receptor signalling [15]. Of the specific bacterial groups analysed, the Bifidobacterium population was significantly reduced in faecal samples of untreated CD patients as compared with controls. Bifidobacterium populations significantly decreased or slightly decreased in faeces of IBD patients, as detected by cultural techniques and real time PCR, respectively [16]. The benefits obtained by administering some Bifidobacterium strains as part of probiotic mixtures or symbiotics (probiotics combined with prebiotics) in ulcerative colitis and pouchitis also support the notion that this bacterial group is relevant to IBD [17]. C. histolyticum, C. lituseburense and F. prausnitzii groups were present in higher proportions in healthy individuals than in CD patients; particularly, the abundance of C.

J Mater Chem 2011, 21:6020.CrossRef 14. Zhang SB, Wei SH, Zunger A: Intrinsic n -type versus p -type doping asymmetry and the defect physics of ZnO. Phys Rev B 2001, 63:075205.CrossRef 15. Zhang Y, Wang LW, Mascarenhas A: “”Quantum coaxial cables”" for solar energy harvesting. Nano Lett 2007, 7:1264.CrossRef 16. Aranovich JA, Golmayo D, Fahrenbruchn AL, Bube RH: Photovoltaic properties of ZnO/CdTe heterojunctions prepared by spray pyrolysis. J Appl Phys 1980, 51:4260–4268.CrossRef 17. Jasieniak J, MacDonald BI, Watkins SE, Mulvaney P: Solution-processed sintered nanocrystal solar cells via layer-by-layer assembly. Nano Lett 2011, 11:2856–2864.CrossRef 18. Panthani MG, Kurley JM, Crisp RW, Dietz TC, Ezzyat T, Luther JM, Talapin

DV: High efficiency solution processed sintered CdTe nanocrystal solar cells: the role of interfaces. Nano Lett 2014, 14:670–675.CrossRef 19. Lee SH, Zhang XG, Parish CM, Lee HN, Smith DB, He Y, Xu J: Nanocone

tip-film find more solar cells with efficient charge transport. Adv Mater 2011, 23:4381–4385.CrossRef 20. Michallon J, Zanuccoli M, Kaminski A, Consonni V, Morand A, Bucci D, Emieux F, Szambolics H, Perraud S, www.selleckchem.com/products/pf-04929113.html Semenikhin I: Comparison of optical properties of Si and ZnO/CdTe core/shell nanowire arrays. Mater Sci Eng B 2013, 178:665.CrossRef 21. Lévy-Clément C, Katty A, Bastide S, Zenia F, Mora I, Munoz-Sanjose V: A new CdTe/ZnO columnar composite film for Eta -solar cells. Phys E 2002, 14:229.CrossRef 22. Tena-Zaera R, Katty A, Bastide S, Lévy-Clément C, O’Regan B, Muñoz-Sanjosé V: ZnO/CdTe/CuSCN: a promising heterostructure to act as inorganic eta -solar cell. Thin Solid Films 2005, 483:372–377.CrossRef 23. Aga RS, Jowhar D, MK-4827 mw Ueda A, Pan Z, Collins WE, Mu R, Singer KD, Shen J: Enhanced photoresponse in ZnO nanowires decorated with CdTe quantum dot. Appl Phys Lett 2007, 91:232108.CrossRef 24. Cao X, Chen P, Guo Y: Decoration of textured ZnO nanowires array with CdTe quantum dots: enhanced light-trapping effect and photogenerated

charge separation. J Phys Chem C 2008, ever 112:20560–20566.CrossRef 25. Aga RS, Gunther D, Ueda A, Pan Z, Collins WE, Mu R, Singer KD: Increased short circuit current in organic photovoltaic using high-surface area electrode based on ZnO nanowires decorated with CdTe quantum dots. Nanotechnol 2009, 20:465204.CrossRef 26. Chen HM, Chen CK, Chang YC, Tsai CW, Liu RS, Hu SF, Chang WS, Chen KH: Quantum dot monolayer sensitized ZnO nanowire-array photoelectrodes: true efficiency for water splitting. Angew Chem 2010, 122:6102–6105.CrossRef 27. Wang X, Zhu H, Xu Y, Wang H, Tao Y, Hark S, Xiao X, Li Q: Aligned ZnO/CdTe core-shell nanocable arrays on indium tin oxide: synthesis and photoelectrochemical properties. ACS Nano 2010, 4:3302.CrossRef 28. Chen ZH, Liu CP, Wang HE, Tang YB, Liu ZT, Zhang WJ, Lee ST, Zapien JA, Bello I: Electronic structure at the interfaces of vertically aligned zinc oxide nanowires and sensitizing layers in photochemical solar cells. J Phys D Appl Phys 2011, 44:325108.CrossRef 29.

12. Sun X, Liu Z, Welsher K, Robinson JT, Goodwin A, Zaric S, Dai H: Nano-graphene oxide for cellular imaging and drug delivery. Nano research 2008,1(3):203–212.Selleck EX 527 CrossRef 13. Zhang LM, Xia JG, Zhao QH, Liu LW, Zhang ZJ: Functional

graphene oxide as a nanocarrier for controlled loading and targeted delivery of mixed anticancer drugs. Small 2010,6(4):537–544.CrossRef 14. Yang K, Zhang SA, Zhang GX, Sun XM, Lee ST, Liu ZA: Graphene in mice: ultrahigh in vivo tumor uptake and efficient photothermal therapy. Nano Lett 2010,10(9):3318–3323.CrossRef 15. Hummers WS, Offeman RE: Preparation of graphitic oxide. J Am Chem Soc 1958,80(6):1339.CrossRef buy NVP-BGJ398 16. Chang YL, Yang ST, Liu JH, Dong E, Wang YW, Cao AN, Liu Y, Wang H: In vitro toxicity evaluation of graphene oxide on A549 cells. Toxicol Lett 2011,200(3):201–210.CrossRef 17. Hu WB, Peng C, Lv M, Li XM, Zhang YJ, Chen N, Fan C, Huang Q: Protein corona-mediated mitigation of cytotoxicity of graphene oxide. ACS Nano 2011,5(5):3693–3700.CrossRef 18. Zhang YB, Ali SF, Dervishi E, Xu Y, Li ZR, Casciano D, Biris AS: Cytotoxicity effects of graphene and single-wall carbon nanotubes in neural phaeochromocytoma-derived PC12 cells. ACS Nano 2010,4(6):3181–3186.CrossRef 19. Raoof M, Cisneros BT, Guven

A, Phounsavath S, Corr SJ, Wilson LJ, Curley SA: Remotely triggered cisplatin release from carbon nanocapsules by radiofrequency fields. Biomaterials 2013,34(7):1862–1869.CrossRef ACY-1215 cell line 20. Si Y, Samulski ET: Synthesis of water soluble graphene. Nano Lett 2008,8(6):1679–1682.CrossRef 21. Raoof M, Corr SJ, Kaluarachchi WD, Massey KL, Briggs K, Zhu C, Cheney MA, Wilson LJ, Curley SA: Stability of antibody-conjugated gold nanoparticles in the endolysosomal nanoenvironment: implications for noninvasive radiofrequency-based cancer

therapy. Nanomedicine 2012,8(7):1096–1105.CrossRef 22. Becerril HA, Mao J, Liu Z, Stoltenberg RM, Bao Z, Chen Y: Evaluation of solution-processed reduced graphene oxide films as transparent conductors. ACS Nano 2008,2(3):463–470.CrossRef 23. Gomez-Navarro C, Weitz RT, Bittner AM, Scolari M, Mews A, Burghard all M, Kern K: Electronic transport properties of individual chemically reduced graphene oxide sheets. Nano Lett 2007,7(11):3499–3503.CrossRef 24. Wörle-Knirsch JM, Pulskamp K, Krug HF: Oops they did it again! Carbon nanotubes hoax scientists in viability assays. Nano Lett 2006,6(6):1261–1268.CrossRef 25. Gass MH, Bangert U, Bleloch AL, Wang P, Nair RR, Geim AK: Free-standing graphene at atomic resolution. Nat Nanotechnol 2008,3(11):676–681.CrossRef 26. Banhart F, Kotakoski J, Krasheninnikov AV: Structural defects in graphene. ACS Nano 2011,5(1):26–41.CrossRef 27. Lotya M, King PJ, Khan U, De S, Coleman JN: High-concentration surfactant-stabilized graphene dispersions. ACS Nano 2010,4(6):3155–3162.CrossRef 28. Krishna V, Stevens N, Koopman B, Moudgil B: Optical heating and rapid transformation of functionalized fullerenes. Nat Nanotechnol 2010,5(5):330–334.CrossRef 29.