aeruginosa. The wild-type and mioC mutant strains of P. aeruginosa PAO1 were purchased from Washington University Genome Center. Antibiotics (tetracycline, 20 μg mL−1; kanamycin, 100 μg mL−1) were added where necessary. The open reading frames of the mioC genes for the mioC over-expressed complementation stain were

PCR-amplified using PAmioC-OE F (CGCAAGCTTAATGCCCGGCTTACCCCTGTTG)/PAmioC-OE R (CGCGGATCCCGTTATTCGCCCTACCGCTTGTCC) primer pairs. The amplified mioC gene fragments were cloned into the HindIII/BamHI sites of pBBR1MCS-2 to yield pBBR1-mioC. The pBBR1-mioC was transformed into E. coli Top10 via electroporation. Small Molecule Compound Library Escherichia coli Top10 cells were grown with aeration at 37 °C in lysogeny broth (LB) medium supplemented with kanamycin (100 μg mL−1). The cells were harvested and pBBR1-mioC isolated using Idasanutlin the MiniPrep plasmid purification kit (Takara). pBBR1-mioC was transformed into P. aeruginosa mioC mutant cell via electroporation. In the cases of the growth and lysis curves, cells were cultured with LB medium at 37 °C with aeration. The cell-free supernatants (CFS) were prepared by filtering a culture of each tested strain through a 0.22-mm pore-size filter (Sartorius). All chemicals were acquired from Sigma (Sigma Chemical, St. Louis, MO) unless otherwise stated. Twenty 96-well PM plates (Biolog Co.) were used

with the following nomenclature: metabolic panels, PM1–PM10; sensitivity panels, PM11–PM20. PM experiments were conducted according to the manufacturer’s

instruction. The cells were inoculated into the PM plates and incubated at 37 °C for 48 h. Cell growth was reflected by the development of purple coloration as monitored and recorded by OmniLog PM Station and PM Kinetic (Biolog). Nintedanib (BIBF 1120) Further information on the compounds tested with the PM kit can be found at the Biolog website. The wild-type, mioC mutant and the mioC over-expressed complementation cells were grown overnight in LB medium and diluted 100-fold with fresh LB medium with vigorous aeration. After the cells reached exponential phase (OD600 nm ~ 0.5), serially diluted cells were spotted on LB agar with paraquat, hydrogen peroxide (H2O2), cumen hydroperoxide (CHP), ampicillin (Amp), gentamicin (Gm), norfloxacin (Nor), 2, 2′-dipyridyl, arsenic (As), zinc (Zn), and copper (Cu). Spotted LB agar plates were grown at 37 °C for 1 day. Polystyrene 96-well microtiter plates (BD Biosciences, San Jose, CA) were utilized as abiotic surfaces for biofilm formation study. Bacterial cultures were grown overnight, washed twice in phosphate-buffered saline and inoculated at 106 CFU mL−1 in LB broth with a variety of substrates. After 48 h of incubation at 30 °C, biofilm formation was determined via crystal violet staining and quantified by measuring the absorbance at 595 nm, normalized by the absorbance at 600 nm (Lee et al., 2010).

Low Rubisco activity was detected that could not account for the carbon dioxide (CO2) fixation rate; in addition, phosphoribulokinase activity was not found. The generation of ribulose 1,5-bisphosphate from 5-phospho-d-ribose 1-pyrophosphate was observed, but not from AMP; these sources for ribulose 1,5-bisphosphate have been proposed before. Our data indicate that the reductive acetyl-CoA pathway is the only functioning CO2 fixation pathway in ‘A.

lithotrophicus’. To date, six autotrophic carbon dioxide (CO2) fixation pathways have been found in nature, three of which GSK2118436 chemical structure occur in Archaea (Berg et al., 2010a). Whereas Crenarchaeota use either the dicarboxylate/hydroxybutyrate or the hydroxypropionate/hydroxybutyrate cycle (Fig. 1), all autotrophic Euryarchaeota studied so far use the reductive acetyl-CoA pathway (Fig. 1c) (Berg et al., 2010a). The functioning of this pathway in Euryarchaeota conforms to the fact that most autotrophic Euryarchaeota are methanogens. They use much of the enzymes involved in energy generation during methanogenesis also for autotrophic acetyl-CoA synthesis. The only known exceptions to

this rule are members of Archaeoglobi (Huber & Stetter, 2001) and perhaps Ferroplasma acidiphilum (Golyshina et al., 2000), whose ability to grow autotrophically was questioned (Dopson et al., 2004). Representatives of the class Archaeoglobi (with only one order and one family, Archaeoglobales and Archaeoglobaceae) are hyperthermophiles CDK inhibitor that grow by means

of anaerobic respiration by oxidizing organic substrates or molecular hydrogen (in some cases, also Fe2+ or S2−) (Huber & Stetter, 2001). The Archaeoglobaceae comprise three Grape seed extract genera: Archaeoglobus, Ferroglobus and Geoglobus. Besides Archaeoglobus profundus and Archaeoglobus infectus, all species can grow autotrophically, with ‘Archaeoglobus lithotrophicus’ being an obligate autotroph (Stetter et al., 1993). Biochemical studies revealed the presence of the enzymes of the reductive acetyl-CoA pathway in ‘A. lithotrophicus’ and Ferroglobus placidus (Vorholt et al., 1995, 1997). The corresponding genes also exist in the Archaeoglobus fulgidus genome (Klenk et al., 1997), whereas the genome of the heterotrophic A. profundus lacks the gene for the key enzyme of this pathway, CO-dehydrogenase/acetyl-CoA synthase (von Jan et al., 2010). Therefore, these data suggest that autotrophic Archaeoglobaceae use the reductive acetyl-CoA pathway for CO2 fixation. Interestingly, the genome of A. fulgidus also harbors, besides the genes of the reductive acetyl-CoA pathway, three copies of genes encoding homologues of the 4-hydroxybutyryl-CoA dehydratase. In contrast, this key enzyme of the dicarboxylate/hydroxybutyrate and hydroxypropionate/hydroxybutyrate cycles is absent in the heterotrophic A. profundus.

Low Rubisco activity was detected that could not account for the carbon dioxide (CO2) fixation rate; in addition, phosphoribulokinase activity was not found. The generation of ribulose 1,5-bisphosphate from 5-phospho-d-ribose 1-pyrophosphate was observed, but not from AMP; these sources for ribulose 1,5-bisphosphate have been proposed before. Our data indicate that the reductive acetyl-CoA pathway is the only functioning CO2 fixation pathway in ‘A.

lithotrophicus’. To date, six autotrophic carbon dioxide (CO2) fixation pathways have been found in nature, three of which buy Ku-0059436 occur in Archaea (Berg et al., 2010a). Whereas Crenarchaeota use either the dicarboxylate/hydroxybutyrate or the hydroxypropionate/hydroxybutyrate cycle (Fig. 1), all autotrophic Euryarchaeota studied so far use the reductive acetyl-CoA pathway (Fig. 1c) (Berg et al., 2010a). The functioning of this pathway in Euryarchaeota conforms to the fact that most autotrophic Euryarchaeota are methanogens. They use much of the enzymes involved in energy generation during methanogenesis also for autotrophic acetyl-CoA synthesis. The only known exceptions to

this rule are members of Archaeoglobi (Huber & Stetter, 2001) and perhaps Ferroplasma acidiphilum (Golyshina et al., 2000), whose ability to grow autotrophically was questioned (Dopson et al., 2004). Representatives of the class Archaeoglobi (with only one order and one family, Archaeoglobales and Archaeoglobaceae) are hyperthermophiles Osimertinib that grow by means

of anaerobic respiration by oxidizing organic substrates or molecular hydrogen (in some cases, also Fe2+ or S2−) (Huber & Stetter, 2001). The Archaeoglobaceae comprise three Thiamet G genera: Archaeoglobus, Ferroglobus and Geoglobus. Besides Archaeoglobus profundus and Archaeoglobus infectus, all species can grow autotrophically, with ‘Archaeoglobus lithotrophicus’ being an obligate autotroph (Stetter et al., 1993). Biochemical studies revealed the presence of the enzymes of the reductive acetyl-CoA pathway in ‘A. lithotrophicus’ and Ferroglobus placidus (Vorholt et al., 1995, 1997). The corresponding genes also exist in the Archaeoglobus fulgidus genome (Klenk et al., 1997), whereas the genome of the heterotrophic A. profundus lacks the gene for the key enzyme of this pathway, CO-dehydrogenase/acetyl-CoA synthase (von Jan et al., 2010). Therefore, these data suggest that autotrophic Archaeoglobaceae use the reductive acetyl-CoA pathway for CO2 fixation. Interestingly, the genome of A. fulgidus also harbors, besides the genes of the reductive acetyl-CoA pathway, three copies of genes encoding homologues of the 4-hydroxybutyryl-CoA dehydratase. In contrast, this key enzyme of the dicarboxylate/hydroxybutyrate and hydroxypropionate/hydroxybutyrate cycles is absent in the heterotrophic A. profundus.

A plan for investment.

A plan for reform. Cm 4818-I. London: HMSO, July 2000. Available at: http://pns.dgs.pt/files/2010/03/pnsuk1.pdf&ei=NJHKUpqHIqiR7AbFl4GwAw&usg=AFQjCNHQ7SYdrNz7Kv-Vcv77eIZYy1wkhw&bvm=bv.58187178,d.bGQ 18 BHIVA. Standards of Care for People Living with HIV 2013. Available at: http://www.bhiva.org/documents/Standards-of-care/BHIVAStandardsA4.pdf (accessed December 2013). 1 Introduction 1.4 Key recommendations We recommend that all patients with HIV and malignancy should be referred to centres that have developed expertise in the management of these diseases (level of evidence 1B). We recommend that clinical networks supporting regional centres of excellence for the treatment of both AIDS-defining and

non-AIDS-defining cancers should be developed as advocated by the Standards of Care for People Living with HIV 2013 [18] (level of evidence 1D). Temsirolimus datasheet 3 Kaposi sarcoma (KS) 3.3 Summary of recommendations We recommend that KS should be confirmed this website histologically (level of evidence 1C). We suggest that CT scans, bronchoscopy and endoscopy are not warranted in the absence of symptoms (level of evidence 2D). We recommend that HAART should be started in all patients diagnosed with KS (level of evidence 1B) We suggest local radiotherapy or intralesional vinblastine for symptomatic or cosmetic improvement in early stage T0 KS (level of evidence 2C) We recommend that patients with T1 advanced stage KS, should receive chemotherapy along with HAART (level of evidence 1B). We recommend that liposomal anthracyclines (either DaunoXome 40 mg/m2 q14d or Caelyx 20 mg/m2 q21d) are first-line chemotherapy for advanced KS (level of evidence 1A). We recommend paclitaxel chemotherapy (100 mg/m2 q14d) for second-line treatment of anthracycline refractory KS (level of evidence 1C). All patients should be considered for clinical trial enrolment if eligible (GPP). 4 Systemic AIDS-related non-Hodgkin lymphoma (ARL) 4.3 Recommendation We recommend that all patients have pathology and treatment plans reviewed by a specialist multidisciplinary team (MDT) and that management is co-ordinated closely with an HIV physician and a haemato-oncologist familiar

with the treatment of such patients (level of evidence 1D). 4.4.5 Recommendations for DLBCL We recommend that patients should be entered into clinical trials, if available (GPP). We recommend that first-line next treatment of DLBCL in HIV-positive individuals includes chemotherapy regimens used in HIV-negative patients, such as CHOP or infusional therapies such as EPOCH. No randomized studies have been published in the era of ART and hence there is no optimal ‘gold-standard therapy’ (level of evidence 1B). We recommend that chemotherapy regimens should be combined with HAART therapy (level of evidence 1B). We recommend the concomitant administration of rituximab (level of evidence IB). Patients with CD4 cell counts <50 cells/μL may require closer surveillance (GPP). 4.5.

The variations in plasma efavirenz pharmacokinetics have been associated with clinical outcomes. Minimum plasma concentrations define therapeutic success, while maximum concentrations define the threshold for adverse drug reactions [17,18]. High intrapatient CP 673451 variability in efavirenz plasma trough concentration, as measured using the integrated pharmacokinetic

adherence measure (IPAM) score, was associated with higher risk of viral rebound [2], while Pfister et al. demonstrated that a 100% increase in clearance above the population mean was associated with clinical failure among highly active antiretroviral therapy (HAART)-naïve patients [10]. In the light of reports that efavirenz-based regimens are superior to other regimens in terms of efficacy, cost-effectiveness and dosing convenience [19], efavirenz is currently used in first-line regimens in most resource-limited settings, and so a better understanding of the pharmacokinetics of efavirenz and the clinical outcomes of efavirenz treatment in African populations is needed. The aim of this study was to obtain a detailed understanding of the pharmacokinetics of the nonnucleoside reverse transcriptase inhibitor efavirenz in HIV-infected, antiretroviral therapy (ART)-naïve Ugandans during the initial treatment period. Consenting HIV-seropositive Ugandan patients initiating

efavirenz-based HAART regimens at Bwera Hospital in south-western Galunisertib manufacturer Uganda between September 2007 and March 2009 were screened for participation in the study. All participants were screened for tuberculosis, alcoholism, pregnancy, psychiatric illnesses, previous antiretroviral experience and risk of nonadherence to therapy and schedule. At the time, the centre used the Centers for Disease Control and Prevention (CDC)/World Health Organization (WHO) classification to decide whether or not

to initiate patients on ART. CD4 testing was therefore Thiamine-diphosphate kinase offered to all patients selected to start ART, and this was also considered a screening procedure, as patients whose CD4 cell counts were found to be above the national cut-off were not started on treatment. All patients reported that they took 960 mg of cotrimoxazole daily for Pneumocystis carinii pneumonia (PCP) chemoprophylaxis prior to and during the study period. All enrolled participants were administered a standardized diet with a limited fat content, and were admitted overnight on the 1st and 14th days of treatment for clinical evaluation, observed dosing and blood collection. They were all initiated on a first-line regimen according to the national policy; this regimen consisted of 150 mg lamivudine/300 mg zidovudine (Combivir®; Hetero House, Hyderabad, Andhra Pradesh, India) taken twice a day, and 600 mg efavirenz (Stocrin®; Merck, Sharpe & Dohme, Whitehouse Station, NJ, USA) taken once every evening (17:00–20:00 h).

Therefore, a study with a larger sample size is needed to clarify the relationship between anti-TNF therapy and endothelial function in patients with RA. In addition, we only performed FMD examination, and did not examine microvascular endothelial function or induced macrovascular dilation using glyceryl trinitrate, which are well-known global measures of endothelial function. Furthermore, the links between systemic inflammation, and vascular function and morphology in patients with RA are not completely supported, as noted in a recent systematic review.[44] Further studies, involving evaluation of both microvascular and macrovascular endothelial function, with much larger numbers of subjects and longer

follow-up periods are warranted to validate the present findings. In conclusion, the present results demonstrate significant associations between the FMD measurements, disease activity and anti-TNF therapy among randomly selected patients with RA. CT99021 mw Anti-TNF therapy may influence endothelial function more than conventional DMARD therapy. Prospective longitudinal studies examining whether check details anti-TNF therapy is able to improve endothelial function are required. None declared. No funding. TW conceived and designed the study, collected the data, was responsible for the statistics, and drafted and translated the paper. MT conceived the study.

MS conceived the study and advised the translation of the paper. HM advised the statistical evaluation. MS advised the translation of the paper. KS designed the study. TM designed

the study, and was study adviser. “
“To validate the Thai version of the Health Assessment Questionnaire (HAQ) for patients with psoriatic arthritis (PsA). The Thai version of the HAQ was administered to 47 patients with PsA attending our rheumatology clinic. Clinical assessments included the measures of disease activity, disease severity and functional status. The correlation of the single items and total score of the Thai HAQ with the measures of disease activity, disease severity and functional status was assessed using Pearson’s correlation or Spearman rank correlation, as appropriate. Of 47 patients who fulfilled the Classification Criteria for Psoriatic Arthritis (CASPAR), 21 were male. Their mean age ± standard deviation (SD) and however mean disease duration ± SD were 49 ± 10 years and 6.97 ± 6.17 years, respectively. Spondylitis was the most common manifestation (38%). The mean Thai HAQ score was 0.47. The single items and total score of the Thai HAQ were moderately to highly correlated with several measures of disease activity (r = 0.32–0.81, P < 0.01), except for swollen joint count (r = 0.16). For functional status and disease severity, the Thai HAQ was moderately correlated with grip strength (r = −0.39, P < 0.01), but poorly correlated with the range of spinal movement and the number of damaged joints. (r = −0.01 to 0.17).

Therefore, a study with a larger sample size is needed to clarify the relationship between anti-TNF therapy and endothelial function in patients with RA. In addition, we only performed FMD examination, and did not examine microvascular endothelial function or induced macrovascular dilation using glyceryl trinitrate, which are well-known global measures of endothelial function. Furthermore, the links between systemic inflammation, and vascular function and morphology in patients with RA are not completely supported, as noted in a recent systematic review.[44] Further studies, involving evaluation of both microvascular and macrovascular endothelial function, with much larger numbers of subjects and longer

follow-up periods are warranted to validate the present findings. In conclusion, the present results demonstrate significant associations between the FMD measurements, disease activity and anti-TNF therapy among randomly selected patients with RA. buy PXD101 Anti-TNF therapy may influence endothelial function more than conventional DMARD therapy. Prospective longitudinal studies examining whether http://www.selleckchem.com/products/bgj398-nvp-bgj398.html anti-TNF therapy is able to improve endothelial function are required. None declared. No funding. TW conceived and designed the study, collected the data, was responsible for the statistics, and drafted and translated the paper. MT conceived the study.

MS conceived the study and advised the translation of the paper. HM advised the statistical evaluation. MS advised the translation of the paper. KS designed the study. TM designed

the study, and was study adviser. “
“To validate the Thai version of the Health Assessment Questionnaire (HAQ) for patients with psoriatic arthritis (PsA). The Thai version of the HAQ was administered to 47 patients with PsA attending our rheumatology clinic. Clinical assessments included the measures of disease activity, disease severity and functional status. The correlation of the single items and total score of the Thai HAQ with the measures of disease activity, disease severity and functional status was assessed using Pearson’s correlation or Spearman rank correlation, as appropriate. Of 47 patients who fulfilled the Classification Criteria for Psoriatic Arthritis (CASPAR), 21 were male. Their mean age ± standard deviation (SD) and Erlotinib manufacturer mean disease duration ± SD were 49 ± 10 years and 6.97 ± 6.17 years, respectively. Spondylitis was the most common manifestation (38%). The mean Thai HAQ score was 0.47. The single items and total score of the Thai HAQ were moderately to highly correlated with several measures of disease activity (r = 0.32–0.81, P < 0.01), except for swollen joint count (r = 0.16). For functional status and disease severity, the Thai HAQ was moderately correlated with grip strength (r = −0.39, P < 0.01), but poorly correlated with the range of spinal movement and the number of damaged joints. (r = −0.01 to 0.17).

0001) (Table 1). Of the resistance mutations detected in the 61 patients with sequenced virus (of the 69 selected patients) at the therapy-naïve stage, 90% were present in CD4 cells and 66% PI3K inhibitor in the plasma. Fifty-five per cent of PR mutations (n=20) and 56% of RT mutations (n=9) were present simultaneously in CD4 cells and plasma. The proportion of mutations detected in the DNA and the proportion detected with standard RNA genotyping were statistically significantly different by the χ2 test (P<0.0001). We can therefore conclude that the difference in detected mutations is not attributable to chance. The kappa

coefficient was 0.71, which means that there was substantial agreement between the two methods in naïve patients [39]. One patient (patient 7) had the M46L PR key mutation selleck inhibitor in both plasma and cells, while patient 33 had the M46M/I mixed population only in the plasma (3% of 61 patients). The M46I or L mutation confers

high resistance to indinavir (IDV). Eight per cent of patients (n=61) had at least one RT mutation in the plasma while 15% had at least one RT resistance mutation in CD4 cells. Seven key mutations were detected in different patients (11.5% of the 61 patients and 10% of all included patients) and four of these (M184M/V, M184M/I, K103K/N and M46M/I) were only found in the cells (data shown for followed patients). For the 40 patients with follow-up samples (see Tables 2 and 4 below), three of the key mutations detected at the naïve stage were present in the RT and PR genes (M46L, M46M/I and K103K/N) of patients 7, 33 and 37. The K103K/N mixed population was not found in the plasma. One treatment-naïve patient

(patient 9 in Table 3) had virus with an RT resistance profile (67N, 70R and 219Q) in both CD4 cells and plasma. Global analysis of the resistance revealed identical results in 93% of CD4 cells and plasma. Twenty-five patients remained therapy naïve, and eight of these untreated patients were followed. The genotyping results for both the RT and the PR resistance mutations in plasma and CD4 cells from these patients are shown in Table 2. One of the eight patients had one revertant RT resistance mutation (T215L Thiamine-diphosphate kinase in patient 7), while two patients had a PR mutation, including one key mutation (M46L in patient 7). Although one patient (patient 3) showed a new key RT mutation (M184I) after 12 months, which was present only in the cells, follow-up data for resistance mutations in the plasma and CD4 cells demonstrated stable mutation patterns. Patients 3 and 7 showed mutations in the second sample that were not detected in the first sample; this was probably a result of the known low sensitivity of direct sequencing for detecting minor populations. The genotyping results for RT and PR resistance mutations in plasma and CD4 cells from the NNRTI-treated patients are shown in Table 3.

We examined changes in mtDNA quality by calculating the ratio of region learn more 2 mtDNA copy number to region 1 mtDNA copy number. mtRNA gene expression was expressed as a log ratio of the concentration of either mitochondrial gene to the

concentration of the housekeeping gene 18S ribosomal RNA (18SrRNA). Primers used in quantitative PCR have previously been reported elsewhere [22], with the exception of 18SrRNA (forward ATGGCCGTTCTTAGTTGGTG; reverse CGCTGAGCCAGTCAGTGTAG; GeneBank accession NR_003286). In the clinical substudy, baseline characteristics including age, gender, BMI, Centers for Disease Control and Prevention (CDC) stage, CD4 T-cell count, HIV RNA, and biochemical parameters were investigated as potential predictive factors associated with the development of LA or SHL in a univariate analysis (Cox model). Characteristics yielding a P-value <0.05 in

the univariate analysis were analysed in a multivariate Cox model. PD-0332991 datasheet In the molecular substudy, differences in mtDNA or mtRNA at baseline and time of event and changes in mtDNA or mtRNA from baseline to time of event were compared using a Wilcoxon rank-sum test. Values reported are medians and interquartile ranges (IQRs) unless otherwise stated. Between February 1999 and April 2002, 915 participants were randomized in 21 countries. Four participants subsequently found not to have been antiretroviral naïve at baseline were excluded from the analyses. Of 911 patients followed for a median of 192 weeks, Reverse transcriptase 14 [eight (57%) male] developed SHL and 10 [seven (70%) male] developed LA. The median

time to event was 49 weeks (IQR 39, 57 weeks), with the majority of cases occurring within 1 year of commencing therapy (Fig. 1). Incidence rates are summarized in Table 1. Two subjects with LA died during follow-up, and in both cases the CERC attributed the cause of death to LA. No subject with SHL died. Differences in baseline characteristics between cases and controls are outlined in Table 2. Cases were more likely to be female [nine (38%) vs. 182 (21%), respectively; P=0.05] and to have a BMI at baseline >25 kg/m2 [11 (48%) vs. 198 (25%), respectively; P=0.02; Fig. 1]. No other parameters (including routine clinical, haematological and biochemical parameters) were found to be predictive of development of LA/SHL. There was no difference between treatment arms in the development of LA/SHL. In multivariate analyses, only BMI at baseline >25kg/m2 remained an independent predictor of the development of LA and SHL (P=0.03). In a multivariate model including baseline BMI adjusted for ddI and d4T daily dose at initiation of treatments, BMI remained statistically significant (P=0.01). Neither ddI dose (P=0.31) nor d4T dose (P=0.87) was significantly associated with LA/SHL. Baseline characteristics of cases and controls in the molecular substudy are listed in Table 3.

, 2005). Since those studies, strains of G. sulfurreducens that produce substantially more filaments than strain DL-1 have been identified (Yi et al., 2009; unpublished data), and continued examination of the genome sequence

has revealed additional genes that could potentially encode filament proteins other than PilA. Therefore, the composition of filaments in G. sulfurreducens was investigated further. Geobacter sulfurreducens strain DL-1 (Caccavo et al., 1994) was obtained from our laboratory culture collection. BKM120 Geobacter sulfurreducens strain MA was selected after routine subculturing of strain DL-1 in a medium with acetate as the electron donor and fumarate as the electron acceptor, and exhibited increased this website attachment to glass. Both strains were routinely cultured under anaerobic conditions in NB medium with acetate (10 mM) and fumarate (40 mM) as described previously (Coppi et al., 2001) at 30 °C. For experiments requiring the production of filaments or biofilms, strains were grown in an acetate–fumarate freshwater medium (Coppi et al., 2001) at 25 °C. When required, chloramphenicol was used at a concentration of 15 μg mL−1, spectinomycin at 75 μg mL−1,

and kanamycin at 200 μg mL−1. Genomic DNA extractions from G. sulfurreducens were performed using a MasterPure Complete DNA and RNA purification kit (Epicenter Technologies, selleck chemicals llc Madison, WI). Plasmid purification, PCR product purification, and gel extractions were carried out using QIAprep Spin miniprep kits, QIAquick PCR purification kits,

and QIAquick gel extraction kits (Qiagen Inc., Valencia, CA), respectively. Routine DNA manipulations were performed according to Sambrook et al. (1989). Ligations were carried out using Quick T4 DNA ligase (New England Biolabs, Beverly, MA) or a TOPO TA cloning kit (Invitrogen, Carlsbad, CA). PCR amplifications for cloning purposes contained the Platinum Pfx DNA Polymerase (Invitrogen). The pilA-MAΔ mutant strain was generated by introducing the previously described pilA-specific mutagenic fragment (Reguera et al., 2005) into the MA strain using a previously described protocol (Coppi et al., 2001). The double mutant pilA/oxpG-MAΔ was produced by electroporating an oxpG-specific mutagenic fragment (Mehta et al., 2006) into the pilA-MAΔ mutant. To produce the quadruple mutant, a mutagenic fragment containing a spectinomycin resistance gene flanked by the 501 bp upstream of the pilA gene and by the 595 bp downstream of GSU1497 was introduced into DL-1–MA to generate the mutant pilA/GSU1497-MAΔ. The components of the mutagenic fragment were produced by PCR using the primers specified in Supporting Information, Table S1, restriction digested using enzymes specific to restriction sites introduced by the primers, and ligated to the spectinomycin cassette.