Within Dasatinib concentration 3 h the fresh weight of dead bees was only reduced by 2.3% in sunshine (from 103.5 ± 9.8 mg (mean ± SD) to 101.1 ± 9.9 mg, 8 bees, Ta = 22.8 °C, radiation = 790 W m−2), and by 0.9% in shade (from 99.7 ± 13.0 to 98.8 ± 12.9 mg, 8 bees, Ta = 18.5 °C, radiation = 180 W m−2).

Therefore, the dead bees’ heat capacity remained rather constant in our measuring periods. Relative humidity in shade was 47.2% in immediate vicinity to the bees and 39.1% about 1 m beside the water barrel (measured with 5 mm diameter miniature sensors, AHLBORN FHA646-R). Weight loss per bee equals an evaporative heat loss of 0.5 mW in sunshine and 0.2 mW in shade. A main disadvantage of dried carcasses is their strongly reduced heat capacity, which influences their reaction to convection. In insects (bees) with a weight smaller than 30–40 mg the cooling rate increases especially steep (Bishop and Armbruster, 1999). Drying bees in turbulent air at a temperature of 65 °C for

selleck kinase inhibitor 26 h (until they reached a constant weight) reduced their weight from 96.4 ± 16.7 mg to 30.0 ± 5.3 mg (12 bees). This reduced their heat capacity by about 69.9% (from about 0.323 to 0.101 J °C−1, using a specific heat of 3.35 J °C−1 g−1 for biological tissues). This is much higher than the decrease in fresh carcasses within a measurement period of 3 h (2.3% in sunshine and 0.9% in shade, see above). Another disadvantage of dried bees

Oxalosuccinic acid is their reduced body surface area. Drying reduced the cross-sectional area by 25.6% (from 52.6 ± 3.2 to 39.1 ± 2.6 mm−2, 12 bees), mainly because of a strong shrinking and bending of the abdomen. This means a reduction of absorbed radiation of roughly 10.6 mW per bee (at 790 W m−2). In dried specimens we were not able to expand the abdomen to its original length. However, in our freshly killed bees we could do this. If one assumes a partly (50%) restoration of the dried specimens’ absorbing area, there remains a loss of about 5.3 mW per bee (at 790 W m−2). This is about 10 times the error caused by evaporative heat loss of fresh carcasses (see above). Hadley et al. (1991) demonstrated that even in a desert cicada which is able to exhibit considerable evaporative cooling at high ambient temperatures, evaporation causes just a small temperature depression (<0.4 °C) at ambient temperatures below 37.5 °C. When we integrate the evaporative heat loss of fresh carcasses in sunshine and shade into Fig. 6 by reducing the radiative heat gain (W m−2) accordingly (considering the honeybee body surface area, Woods et al., 2005), the resulting shift of the regression lines increases the Tth − Ta values at a given radiation by only about 0.1 °C. Therefore, we conclude that any evaporative temperature “error” in our dead bees is below ∼0.2 °C.

A central pathology review

was performed. Stratification factors included: number of metastatic regional lymph nodes (N1: 1–3 vs N2: ≥4), histologic grade (high: poorly differentiated/undifferentiated] vs low: well/moderately differentiated), and T stage. Proximal tumor site included cecum, ascending, hepatic flexure, and transverse colon; distal site included splenic flexure, descending and sigmoid colon. The study was approved by the Mayo Clinic Institutional Review Board and the North Central Tariquidar ic50 Cancer Treatment Group (NCCTG; now part of Alliance for Clinical Trials in Oncology). Each participant signed an Institutional Review Board–approved informed consent in accordance with current guidelines. Data quality was ensured by review by the Alliance Statistics and Data Center. All authors had access to the study data and reviewed and approved the final manuscript.

Mutation status was determined using genomic DNA extracted from macrodissected, formalin-fixed, paraffin-embedded tumor tissue that contained at least 60% tumor cells. Testing for the c.1799T>A p.V600E www.selleckchem.com/products/VX-809.html BRAF mutation in exon 15 was performed using a multiplex allele-specific, real-time polymerase chain reaction–based assay and an automated sequencing technique. 27 Primer sequences included: wild-type forward [NED-TGATTTTGGTCATGCTACAGT]; mutant forward [6-Fam-CAGTGATTTTGCTCTAGCTTCAGA]; and reverse

Galeterone [GTTTCTTTCTAGTAACTCAGCAGC]. KRAS mutation status in exon 2 was analyzed in extracted DNA using the DxS mutation test kit KR-03/04 (DxS, Manchester, UK), assessing for 7 different mutations in codons 12 and 13. 28 For both genes, mutational analysis was performed in a Clinical Laboratory Improvement Amendments–compliant laboratory at Mayo Clinic. MMR protein (MLH1, MSH2, and MSH6) expression was analyzed in formalin-fixed, paraffin-embedded tumor sections as described previously.12 MMR protein loss was defined as absence of nuclear staining in tumor cells but positive nuclear staining in normal colonic epithelial cells and lymphocytes. Expression was scored by a gastrointestinal pathologist (TCS). Tumors were categorized as having dMMR if loss of at least one MMR protein was detected and pMMR if all proteins were intact. Promoter methylation of MLH1 was determined in BRAF nonmutated tumors in an effort to distinguish sporadic from familial dMMR patients. Tumor DNA was extracted from formalin-fixed, paraffin-embedded tissue and bisulfite modified using the EZ DNA Methylation Kit (Zymo Research Corp., Irvine, CA). Polymerase chain reaction primers were designed to detect differences between methylated and unmethylated DNA for the hMLH1 promoter, as described.

As a direct response to the losses sustained by the fishing community from this hurricane, fishers have developed more risk-averse fishing practices (Table 3). For example, the majority

of fishers (n=16) now bring some or all of their traps inland or inshore at the start of the hurricane season, although specific strategies vary among individuals. A few fishers (n=2) also adjust their traps by adding different buoys or rope to increase trap robustness to storm impact. Only three respondents stated that they have not changed their fishing practices, BMN 673 mouse and continue to leave their traps in the fishing grounds regardless of hurricane risk. Considering the impacts of previous hurricanes on the fishing community in Anguilla, fishers were understandably concerned about future hurricane impacts. When asked how they would feel if hurricane risk increased, 12 respondents stated that they would be very concerned.

Five of these respondents stated that they would be concerned about the impact specifically on their fishing, and may consider another occupation. Perceptions relating to broader implications of environmental change elicited fewer responses (n=7), including specific concerns about coral bleaching (n=2), sea-level rise (n=1) and increases in sea temperature affecting fish movement (n=1). With regards to environmental changes in the fishery, of greatest concern to these respondents were the changes in fish Tyrosine-protein kinase BLK abundance. The majority of respondents considered that at present there are fewer fish (n=16) and smaller fish (n=6) than there were PD-0332991 clinical trial 20 years ago, particularly reef fish species such as groupers and parrot fish. Responses related the changes in fish abundance to an increase in the number of fishers (n=7) and irresponsible fishing practices (n=3),

such as ‘ghost fishing’ from abandoned traps. One respondent perceived the problem of overfishing to be caused by the number of traps in use, rather than the number of fishers; while another stated that modern fishing gear has increased the effectiveness of fishing in Anguilla. As a result, a small number of respondents wanted to see changes to current fishery regulations, through implementing seasonal bans (n=5), no-take areas (n=1) and a ban on spear-fishing (n=1). There was greater demographic variation among the 13 tourist operators in comparison to the fisher group. While most (n=10) of the tourist operators were male, there were also three women running marine-dependent tourist businesses. The majority of respondents in this group were Anguillian nationals (n=11) but two were European. Under half of the respondents were married (38%, n=5), and slightly more had children (46%, n=6). More respondents in this group had achieved a higher level of education, with three having been to university. The most common age category for these respondents was the 35–44 year group (n=7).

Jednocześnie ustawodawca przewidział podejmowanie interwencji medycznej bez zgody uprawnionego podmiotu, a nawet przy jego sprzeciwie

[3]. Mamy tu na myśli m.in. zastosowanie środków przymusu bezpośredniego. Zastosowanie przymusu bezpośredniego to wyjątek od zasady pełnej autonomii pacjenta [4]. Jest to niewątpliwie działanie stanowiące ograniczenie jego wolności. A zaznaczyć należy, że wolność człowieka podlega fundamentalnej ochronie przewidzianej w przepisach Konstytucji RP [5]. Nie jest to jednak ochrona bezwzględna. Jej ograniczenia mogą być ustanawiane w ustawie, gdy są ABT-263 supplier konieczne m.in. dla ochrony zdrowia albo wolności i praw innych osób (art. 31 Konstytucji RP). Czasem konieczne jest traktowanie środków przymusu bezpośredniego jako służących leczeniu chorego [6]. Jest to zawsze działanie kontrowersyjne, budzące wątpliwości nie tylko natury prawnej, ale także etycznej. Erastin in vivo Powstaje zatem pytanie, kiedy i po spełnieniu jakich przesłanek można w toku postępowania diagnostyczno-terapeutycznego środki te stosować u dzieci? Udzielenie odpowiedzi na to pytanie wymaga krótkiego przedstawienia

regulacji prawnych odnoszących się do stosowania środków przymusu bezpośredniego. Przy czym już na wstępie zaznaczyć należy, że formy przymusu bezpośredniego stosowane wobec małoletnich nie różnią się od stosowanych wobec osób dorosłych [7]. Przymus bezpośredni polega na zastosowaniu określonych środków fizycznych, technicznych lub chemicznych celem podporządkowania osoby, wobec której przymus jest stosowany z woli podmiotu uprawnionego do jego stosowania [8]. Od przymusu bezpośredniego odróżnić należy przymus pośredni. Przymus pośredni występuje wówczas, gdy przepis prawa zastrzega różne sankcje, np. karne bądź administracyjne, na wypadek odmowy zgody na zabieg medyczny [9].

Tytułem przykładu wskazać można środki przymusu pośredniego określone w art. 115 Kodeksu wykroczeń [10]. Jeżeli osoba sprawująca pieczę nad osobą małoletnią lub bezradną, pomimo zastosowania środków egzekucji administracyjnej, nie poddaje jej określonemu obowiązkowemu szczepieniu ochronnemu, podlega karze grzywny do 1500 zł lub karze nagany. Ustawodawca, zgodnie z zasadą określoną w art. 31 Konstytucji RP, w aktach prawnych rangi ustawowej określa przesłanki stosowania środków przymusu bezpośredniego oraz PRKACG ich rodzaj. Ustawa o ochronie zdrowia psychicznego [11] w art. 18 przewiduje stosowanie przymusu bezpośredniego wobec osoby z zaburzeniami psychicznymi, przy wykonywaniu czynności przewidzianych w tej ustawie, wtedy gdy przepis do tego upoważnia albo zachowanie pacjenta odpowiada zachowaniom określonym w przepisach ustawy. W drugim przypadku przymus bezpośredni może być zastosowany, gdy pacjent podejmie działania, które zawierają w sobie rzeczywiste zagrożenie wywołania poważnych następstw [12]. Jednocześnie w ustawie określony został katalog środków przymusu bezpośredniego, który może być stosowany.

, 2014). Understanding changes in seagrass parameters through time and setting reference points for future analysis will be integral to our ability as seagrass scientists to provide advice on future coastal management. At local and regional scales there is an increasing need to justify the protection of marine environments, and quantifying ecosystem services is a key means of providing that justification. Although it is often quoted that seagrasses provide high levels of these ecosystem services

the data underpinning this is often geographically weak. This special issue provides three manuscripts that help to fill gaps about the importance Akt inhibitor of the seagrass ecosystem in terms of directly supporting food security and human well-being through supporting fisheries productivity

and small scale fisheries. These include a global view of coupled social–ecological systems (Cullen-Unsworth et al., 2014) and analyses of the ecosystem service values of the seagrass meadows from very different systems in the United Kingdom (Bertelli and Unsworth, 2014) and eastern Africa (de la Torre-Castro et al., 2014). Increasing global interest now also focuses on a relatively newly appreciated ecosystem service provided by seagrass; its capacity to sequester carbon. The special issue includes a review of the modeling of the carbon sequestration capacity of seagrass meadows (Macreadie et al., 2014). Climate change is a significant long-term threat to seagrass. Managing seagrasses for future resilience to climate change is about understanding current stressors and how they Proteases inhibitor may change and about knowledge of temperature and ocean chemistry including C-X-C chemokine receptor type 7 (CXCR-7) developing greater knowledge of distribution limits, understanding ecosystem recovery and defining clear physical thresholds. Research in the special issue uses modeling to predict the upper limit of Posidonia oceanica

distribution ( Vacchi et al., 2014), develops knowledge of species light needs and how those needs interact with the environment ( Yaakub et al., 2014a, Yaakub et al., 2014b and Kenworthy et al., 2014) and determines how deep water seagrasses recover from stress ( Rasheed et al., 2014). There exists increasing evidence of how climate related temperature changes may detrimentally affect seagrasses. Collier and Waycott (2014) investigate the temperatures and times which lead to plant mortality, but in addition and more worryingly for seagrass ecologists, demonstrate the synergistic effect of poor water quality. These complex and until now poorly understood interactions and the potential wider ecosystem effects are also investigated in the special issue study of how ocean acidification influences seagrass tolerance to herbivory (Garthwin et al., 2014). As editors we appreciate the effort of the seagrass research community in undertaking the research that underpins this edition.

029 °C per milliwatt of power dissipated by an electrode array with 100 electrodes, however the power dissipation was based on the system operating as a neural recording device only; we expect that a stimulating array would not only influence local temperatures via increasing metabolism, but it would also consume

more power and result in greater heat accumulation. While further study in this area is clearly required to determine the safe limits of operation for a multi-array cortical visual prosthesis, a possible solution to the problem may be incorporating temperature sensors into the implants, which was recently demonstrated in a subretinal visual prosthesis (Liu et al., 2014). Preventing the ingress of bodily fluids will be essential for maintaining

the functionality and longevity of a visual prosthesis, ABT-263 ic50 and will require the tight sealing of all joins between materials comprising the electrode arrays. A detailed treatment of the engineering, materials design and manufacturing issues involved is beyond the scope of this review, however it is noteworthy that in-vitro testing of an encapsulated Utah slant array over a period of 9 months JAK pathway revealed no deterioration of device performance that would indicate a failure of hermetic sealing (Sharma et al., 2011). Moreover, with reports of neural recording arrays functioning in-vivo in humans (Hochberg et al., 2012) over periods of 5 years, manufacturing techniques have clearly developed to the point that maintenance of array hermeticity over the lifespan of the visual prosthesis will be achievable. The rapidly growing field of medical bionics offers the potential of partially restoring visual function in individuals with severe visual impairment. We have summarized the clinical imperative for a cortical visual prosthesis, the general design principles and some of the major hurdles facing research groups who are currently developing this technology. Our research group, based

at Monash University in Melbourne, Australia, is developing a wireless prosthetic vision system based on cortical microstimulation (Fig. 3) (Lowery, 2013). The project is nearing technical completion, and preclinical, biocompatibility and functional testing of an implantable device is currently underway in normally-sighted sheep and macaques. Farnesyltransferase We anticipate that the results of this study, and others reporting similar progress in the field, should underpin the imminent trial of a new generation of cortical visual prostheses in humans. The authors would like to thank Dr. Jeanette Pritchard for her assistance with proofreading the manuscript, and Mr. Gavin Hawkins for his assistance with the preparation of Fig. 3. This project is funded through the Australian Research Council׳s Research in Bionic Vision Science and Technology Initiative (SRI 1000006). “
“Apoptosis signal-regulating kinase 1 (ASK1, also referred to as MAP3K5)(Ichijo et al.

2C and 2D). Significant differences were not observed in subgroups [V(+24h) and BP(+24h)] in two different sets of experiments conducted at different times. As observed in experiment 1, mice on the control diet for 7, 14 and 28 days [subgroups BP(+8d), BP(+15d), BP(+29d)] showed a time-related significant decrease in total adduct levels as seen by adduct intensity

in the liver and lungs of mice compared to BP(+24h) and subgroup of preceding time point. Interestingly, mice that were shifted to 0.05% curcumin diet and killed at 7, 14 and 28 days [subgroups BP(+8d) + C7d, BP(+15d) + C14d, BP(+29d) + C28d] showed a significantly higher decrease Reverse Transcriptase inhibitor in total levels of adduct intensity in the liver and lungs compared to BP(+24h) and respective time-matched controls [subgroups BP(+8d), BP(+15d),

BP(+29d)] (Figure 2 and Figure 3). This decrease was also evident when comparison of the percentage intensity of nuclei containing high, click here medium and low levels of adducts was made between curcumin-treated and time-matched controls. In the liver, the observed decrease in total adduct intensity appears to be attributed to reduction in percentage intensity of nuclei containing high and low levels of adducts. However, in lungs, it was mainly due to a decrease in intensity of nuclei containing high levels of adducts in mice shifted to 0.05% curcumin diet and killed at 7, 14 and 28 days [subgroups BP(+8d) + C7d, BP(+15d) + C14d, BP(+29d) + C28d] compared to BP(+24h) and respective time-matched controls [subgroups BP(+8d), BP(+15d), BP(+29d)] (Figs. 2C and 2D). These results suggest that dietary curcumin further enhanced the decrease in total adduct intensity in the liver and lungs of mice although the extent of decrease varied. The observed decrease in levels of BPDE-DNA adducts in liver and lungs may be attributed to increased loss

of adducts containing cells and/or enhanced DNA repair and/or dilution of adducted DNA by newly synthesized non-adducted DNA. To investigate the effect of dietary curcumin post-treatment on B(a)P-induced cell turnover in mouse liver and lungs, TUNEL assay was employed. Turnover Idoxuridine of cells by apoptosis in the liver and lungs was measured in a similar area of tissue sections (mm2) and number of cells (∼800 cells/section/animal). Apoptotic index was measured in terms of total apoptotic nuclei intensity as well as the percentage of apoptotic positive and negative cells. Notably, 5-10% and 20-35% of total apoptotic nuclei were detected in the liver and lung tissues of vehicle [V(+24h), V(+48h), V(+96h), V(+144h)] or vehicle + curcumin [V(+48h) + C 24 h, V(+96h) + C 72 h, V(+144h) + C 120 h]-treated subgroups, respectively (Figs.

The use of dNTP analogues in mechanistic studies was reviewed in 2010 by McKenna et al. [ 32], however, this team has recently augmented the dNTP analogue repertoire with a range of α,β-halomethylene-triphosphate systems ( Table 3, entry 2). These systems were prepared chemoenzymatically (e.g. α,β-CF2-dCTP) or using

the morpholidate method (e.g. α,β-CF2–dTTP) to study stereoelectronic effects within the triphosphate group through variation of the halo substituent and subsequent crystallographic studies in the presence of these non-hydrolysable GPCR Compound Library screening analogues [ 33]. In earlier complementary works, McKenna and colleagues employed β,γ-bridge analogues that allowed perturbation of the pyrophosphate leaving group pKa [ 34•• and 35]. Fortunately, the β,γ-halomethylene-GTP analogues were substrates, and their kinetic activities were correlated buy Dasatinib using linear free energy relationships (LFER). Human DNA polβ incorporated β,γ-halomethylene-GTP against both cognate C and non-cognate T template residues, with the chemical step being rate-limiting in both cases. Unsurprisingly, cognate incorporation was markedly faster than non-cognate, however, individually,

the two sets of kinetic data correlated under LFER analyses. Reduced activities were measured for the bulkier dihalogen substrates where the template base was also influential in the magnitude of diminished activity. The detection of even lower catalytic activity for mispairs serves as a potential tool to explore the structural distinctions between transition states derived from cognate or non-cognate base incorporations. The use of substituted methylene bridges, -CXY- potentially introduces an additional stereogenic centre into β,γ-dGTP analogues (Table 3, entry 3). Crystallisation of DNA polβ in the presence of disasterometric mixtures of each of β,γ-CHF, CMeF and CClF dGTP analogues led to selective active site occupancy by the diastereomers that allowed the formation of CX-F-Arg183 hydrogen bonds [36]. Diastereomerically pure β,γ-CHF-dGTP

and β,γ-CHCl-dGTP were prepared and the R and S-configurational isomers were assessed kinetically [37]. R-diastereomers proved more proficient substrates than S, with the R-β,γ-CHF-dGTP being most effective, confirming the advantageous effect of the CX-F-Arg183 interaction [38•]. Synthetic methodologies for the preparation Olopatadine of mRNA cap analogues have been developed to study biotechnologically and medicinally significant cap-dependent processes (Table 3, entry 4) [39, 40, 41 and 42]. The binding and hydrolysis of 5′-cap mimics by the cap scavenger from Caenorhabditis elegans (CeDcpS) were explored using a collection of methylenephosphonate, imidodiphosphate and phosphorothioate cap analogues, revealing regioselective β,γ-cleavage [ 43]. Recent examples include stereopure α-P-boranophosphate-ATPs that have shown anti-hepatitis C activity (Table 3, entry 5) [44] and selective agonism against the P2Y6 receptor (Table 3, entry 6) [45].

Groundwater chemistry is largely controlled by carbonate minerals. While the hydrogeochemical data are broadly

consistent with microbially mediated reductive dissolution of Fe(III) oxyhydroxides being an important mechanism releasing As into the aquifer, further work is required to unambiguously resolve the mechanism(s) and definitively explain the apparent decoupling with Fe2+. Other geochemical processes, e.g., silicate weathering and carbonate dissolution, are primarily responsible for distribution of solutes in Cobimetinib groundwater. This project was funded by Australian Research Council Future Fellowship (Grant no. FT110100130) and Southern Cross University. The authors would like to thank Mr. Makhan Maharjan (ENPHO) for providing blanket testing data

of groundwater arsenic. We also appreciate the support of Environment and Public Health Organization (ENPHO), Nepal Red Cross Society (NRCS), Central Department of Geology (CDG) of Tribhuvan University, Department of Mines and Geology (DMG), Groundwater Resources Development Board (GRDB), HEMS Nepal and ASHA/Nepal for their kind cooperation. We acknowledge the invaluable contribution of Mr. Gyan Prakash Yadav, Ms. Lauren Hook and Er. Om Shrestha during the field study at Nawalparasi. We thank Barbara Harrison for assisting with sample quarantine and Environmental Analysis Laboratory for chemical analyses. We would like to thank anonymous reviewers for their suggestions. J. Diwakar was financially

supported by the Australian Everolimus molecular weight Postgraduate Award/International Postgraduate Research Scholarship (APA/IPRS) provided by Australian Government. Salary support for Scott Johnston was provided by the Australian Research Council Future Fellowship (Grant no. FT110100130). “
“Climate change is predicted to lead to an intensification of the global hydrological cycle (Huntington, 2006). Reverse transcriptase Freshwater resources in dry subtropical regions may be impacted adversely, but favorably affected at higher latitudes (Cisneros et al., 2014). Quantifying current and future freshwater availability is a critical aspect of adapting to changing and variable climate because access to sufficient freshwater is linked to food security, human health, ecosystem health, land use change, economic development, and regional conflicts (Schuol et al., 2008). The Brahmaputra River basin located in south Asia is one of the world’s major river basins for human and ecological needs and supports the livelihoods of over 66 million people through subsistence agriculture. Despite the growing attention to quantify freshwater resources and to assess the vulnerability of freshwater to global change (Alcamo and Henrichs, 2002, Faramarzi et al., 2009, Lehner et al., 2006, Oki and Kanae, 2006, Piao et al., 2010, Schuol et al., 2008, Srinivasan et al., 1998a, Srinivasan et al., 1998b and Vörösmarty et al.

O objetivo do nosso trabalho é avaliar os fatores preditores de resposta a longo prazo da AZA na DII. Partindo de uma base de 360 doentes seguidos em consulta de DII, identificámos 85 que em algum momento do curso da sua doença realizaram tratamento com AZA. O nosso critério de seleção foi o uso da AZA na dose de 2‐2,5 mg/Kg/dia, sem biológico e por um período superior a 3 meses. As indicações para o início da AZA foram doença corticodependente ou corticorrefratária e, no caso particular da DC, por comportamento fistulizante ou após a cirurgia. Treze

doentes foram excluídos, 11 dos quais por efeitos secundários que ocorreram nos primeiros 3 meses de tratamento e 2 por terapêutica concomitante com agentes biológicos. Os efeitos adversos que conduziram à descontinuação da terapêutica foram os seguintes: 5 doentes com toxicidade hepática, 4 doentes com intolerância gástrica, Navitoclax um doente com pancreatite aguda minor e outro com reação alérgica (febre, mal‐estar geral, diarreia e dor abdominal). Estudámos assim, retrospetivamente, 72 doentes. Registámos os parâmetros demográficos, o tipo de doença (DC, CU, DII indeterminada), os parâmetros laboratoriais (PL) – leucócitos, Epigenetics Compound Library ic50 PCR, hemoglobina, plaquetas e VGM – antes e aos 3 meses de tratamento com AZA, bem como terapêutica concomitante com 5‐ASA e corticoide.

Considerámos o tratamento eficaz: 1) doentes que mantiveram o controlo da DII, por critérios clínicos/endoscópicos, sem necessidade de escalada terapêutica, mantendo a AZA por período superior ou igual a 3 meses; 2) suspensão do fármaco por decisão médica, na presença de controlo clínico e na ausência de efeitos secundários. Considerámos o tratamento não eficaz: 1) doentes com necessidade de escalada terapêutica por mau controlo clínico, após o uso da

AZA num período superior ou igual a 3 meses; doentes com mau controlo endoscópico após o uso da AZA num período superior a 6 meses, nos casos em que a remissão foi induzida cirurgicamente; 2) ocorrência de efeitos secundários após esse período de utilização do fármaco que conduziram à suspensão do mesmo. Comparámos os 2 grupos (tratamento eficaz vs. tratamento não eficaz) e usámos análise univariada e multivariada através do SPSS, versão Phenylethanolamine N-methyltransferase 16,0. No nosso estudo foram usados os testes de correlação de Pearson, qui‐quadrado de Pearson, teste t e regressão linear (métodos enter e stepwise). O valor de p < 0,05 foi considerado estatisticamente significativo. Foram incluídos 72 doentes sob terapêutica com AZA, 37 mulheres e 35 homens. A idade média de introdução da AZA foi de 38,0 ± 13,8 (18‐73) anos e a idade média de diagnóstico da DII de 31,8 ± 12,8 (12‐65) anos. O tempo de evolução médio entre o diagnóstico da DII e o início da AZA foi 74,3 ± 81,2 meses. Trinta e cinco doentes apresentavam DC, 34 doentes tinham CU e em 3 doentes a DII era indeterminada.